Perspective: machines for RNAi.

By Yukihide Tomari, Phillip D. Zamore. Genes & Development, 2005

992 citations recorded by the source corpus.

RNA silencing pathways convert the sequence information in long RNA, typically double-stranded RNA, into approximately 21-nt RNA signaling molecules such as small interfering RNAs (siRNAs) and microRNAs (miRNAs). siRNAs and miRNAs provide specificity to protein effector complexes that repress mRNA transcription or translation, or catalyze mRNA destruction. Here, we review our current understanding of how small RNAs are produced, how they are loaded into protein complexes, and how they repress gene expression.

Subfields: Cancer Research, Molecular Biology

View Paper: https://www.semanticscholar.org/paper/eb823ab65416227f7c67798c020957cd99f31f06

How researchers see this paper

The researchers whose trusted networks rank it highest, strongest advocate first. Every researcher gets a different order.

In Cancer Research

In Molecular Biology

Citations in the corpus

TRBP, a regulator of cellular PKR and HIV‐1 virus expression, interacts with Dicer and functions in RNA silencing (2005, background): “Drosophila R2D2 and Loqs are two Drosophila dsRBD proteins that work in conjunction with Dcr2 and Dcr1, acting in RNAi and miRNA pathways, respectively kidney (HEK)293T-REx control cell lines after treatment with tetracycline (Tet) for 72 h as indicated.”
Origins and Mechanisms of miRNAs and siRNAs (2009, background): “Human Ago2 is not the only Ago protein to contain these important residues; indeed, they are found in Ago family members throughout the animal kingdom.”
MicroRNAs: key regulators of stem cells (2009, background): “Pre-miRNAs are then translocated into the cytoplasm by exportin 5–RanGTP and are further processed by Dicer to generate functional miRNA”
A pathway for the biogenesis of trans-acting siRNAs in Arabidopsis. (2005, background): “MicroRNAs (miRNAs) and small interfering RNAs (siRNAs) are 20–24-nucleotide (nt) noncoding RNAs that repress gene expression through sequence-specific interactions with RNA or DNA (Bartel 2004; Tomari and Zamore 2005).”
Cucumber mosaic virus-encoded 2b suppressor inhibits Arabidopsis Argonaute1 cleavage activity to counter plant defense. (2006, background): “The small RNA duplexes are then incorporated into a ribonucleoprotein complex called RNA-induced silencing complex (RISC) that degrades any RNA complementary to small RNAs (Bartel 2004; Tomari and Zamore 2005).”
Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes. (2006, background): “Key factors required for the biogenesis and function of these small RNAs are Dicer and Argonaute proteins (for review, see Tomari and Zamore 2005).”
Passenger-strand cleavage facilitates assembly of siRNA into Ago2-containing RNAi enzyme complexes. (2005, positive): “We have included conformational rearrangements in Ago2 proposed to be associated with target RNA cleavage ( Tomari and Zamore, 2005 ).”
The role of PACT in the RNA silencing pathway (2006, background): “The small RNAs are loaded onto the effector complex, known as the RNA-induced silencing complex (RISC) (Filipowicz, 2005; Sontheimer, 2005; Tomari and Zamore, 2005; Zamore and Haley, 2005).”
Regulatory roles of natural antisense transcripts (2009, background): “These effects are not mediated through the RNAi pathwa”
MicroRNA function: multiple mechanisms for a tiny RNA? (2005, background): “In worms, they were initially found to regulate developmental timing (Wightman et al. 1993), but now we know that they are involved in a wide variety of developmental processes and might have a role in networking and fine-tuning gene expression in the cell (Ambros 2003; Bartel 2004).”
Chapter Five – Progress Towards RNAi-Mediated Insect Pest Management (2014, background): “The general mechanism of dsRNA-mediated degradation of mRNA transcripts is understood (Tomari and Zamore, 2005).”
High-Throughput Sequencing of Arabidopsis microRNAs: Evidence for Frequent Birth and Death of MIRNA Genes (2007, neutral): “miR842 UCAUGGUCAGAUCCGUCAUCC 1 N Y 2 (97) 2 (0) Jacalin lectin At5g38550 (2.5), At1g60130 (2.5), At1g52120 (2.5), [ 3 ]”