Gardening the genome: DNA methylation in Arabidopsis thaliana

By S. Chan, Ian R. Henderson, Steven E. Jacobsen. Nature reviews genetics, 2005

917 citations recorded by the source corpus.

View Paper: https://www.semanticscholar.org/paper/c00a71950f58d2b2c05b141494015947765cd1a9

How researchers see this paper

The researchers whose trusted networks rank it highest, strongest advocate first. Every researcher gets a different order.

In Plant Science

Citations in the corpus

High-Throughput Sequencing of Arabidopsis microRNAs: Evidence for Frequent Birth and Death of MIRNA Genes (2007, neutral): “miR858 UUUCGUUGUCUGUUCGACCUU 1 N N 55 (4) 0 (0) MYB transcription factor At2g47460 (2.5), At3g08500 (3), At5g35550 (3), [ 6 ]”
Small RNA sorting: matchmaking for Argonautes (2010, background): “Effector proteins, such as the chromatin-remodelling factor DRD1, the de novo methyltransferase DRM2 and other factors, are then recruited, resulting in DNA methylation at cytosine residue”
Post-transcriptional small RNA pathways in plants: mechanisms and regulations. (2006, background): “Methylation-deficient mutants exist in Arabidopsis (Chan et al. 2005), but these mutants have not been reported to have developmental abnormalities that could result from defects in PHB or PHV expression; however, the methylation status of PHB and PHV has not been examined in these mutants.”
Conservation and divergence of methylation patterning in plants and animals (2010, background): “Furthermore, the lack of CHG andCHHmethylation targeted to transposons is consistent with the apparent absence of a Dnmt3/DRM2 homolog in Chlamydomonas (8, 9), and that the closest CMT3 homolog is highly diverged relative to flowering plants (Fig.”
Establishing, maintaining and modifying DNA methylation patterns in plants and animals (2010, background): “In plants, de novo methylation is catalysed by DOMAINS REARRANGED METHYLTRANSFERASE 2 ( DRM2 ), a homologue of the DNMT3 methyltransferases, and maintained by three different pathways: CG methylation is maintained by DNA METHYLTRANSFERASE 1 (MET1, also known as DMT1 ), the plant homologue of DNMT”
Potato Shoot Tip Cryopreservation. A Review (2011, background): “DNA methylation is required for regular development of plants and may have an impact on vigour and morphogenesis (Chan et al. 2005).”
Genome-wide high-resolution mapping and functional analysis of DNA methylation in arabidopsis. (2006, methodology): “A fraction of the recovered DNA was used for real-time PCR to determine the amount of the methylated FWA promoter, AtSN1, and Ta3 as well as the unmethylated ACTIN promoter in each fraction (Figure 1A).”
Dissecting Arabidopsis thaliana DICER function in small RNA processing, gene silencing and DNA methylation patterning (2006, neutral): “MicroRNAs (miRNAs) and trans -acting small interfering RNAs (tasiRNAs) regulate mRNA stability and translation, and siRNAs cause post-transcriptional gene silencing of transposons, viruses and transgenes and are important in both the establishment and maintenance of cytosine DNA methylatio”
Active DNA Demethylation Mediated by DNA Glycosylases (2009, neutral): “Plants also have non-CpG methylation; CpNpG (N is A, T, or C) methylation is maintained by CMT3 (chromodomain methyltransferase 3), a plant-specific enzyme, whilst asymmetric CpNpN methylation cannot be maintained (it must occur de novo) and is carried out by DRM2 and directed by 24-nt small interfe”
A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana. (2006, background): “The concerted activity of plantspecific DNA-dependent RNA polymerases, PolIVa and PolIVb, correlates with the accumulation of 24-nt heterochromatic siRNAs via RDR2-mediated dsRNA formation and DCL3-mediated processing (Xie et al. 2004; Chan et al. 2005).”
DNA methylation landscapes: provocative insights from epigenomics (2008, background): “Most significant is the presence of non-CpG methylation in plants that is targeted to transposable elements by a mechanism that depends upon small interfering RNAs (siRNAs”
Comprehending crystalline β-carotene accumulation by comparing engineered cell models and the natural carotenoid-rich system of citrus (2011, neutral): “Furthermore, CMTs also play a role in de novo methylation (Cao et al., 2003; Chan et al., 2005).”
Stress-induced DNA methylation changes and their heritability in asexual dandelions. (2010, background): “Variation in methylation stability between loci may result from differences in the underlying mechanisms that generate and maintain DNA methylation in different genomic contexts (Chan et al., 2005).”