Differentiation of Lactobacillus plantarum,L. pentosus, and L. paraplantarum by recA Gene Sequence Analysis and Multiplex PCR Assay with recA Gene-Derived Primers

By S. Torriani, G. Felis, F. Dellaglio. Applied and Environmental Microbiology, 2001

619 citations recorded by the source corpus.

How researchers see this paper

The researchers whose trusted networks rank it highest, strongest advocate first. Every researcher gets a different order.

Identification of lactic acid bacteria and yeast from boza (2007, methodology): “1 mL Takara Taq was used in a 30-cycle amplification [9].”
Diversity of lactic acid bacteria and yeasts in Airag and Tarag, traditional fermented milk products of Mongolia (2008, methodology): “planF CCGTTTATGCGGAACACCTA recA gene of Lactobacillus plantarum 9–28 Torriani et al. (2001) pREV TCGGGATTACCAAACATCAC recA gene of L. plantarum group 327–308 Torriani et al. (2001)”
Lactobacillus Plantarum: Characterization of the Species and Application in Food Production (2010, methodology): “( 30 , 31 ) Other species-specific primers, such as F (5´-AAT TGA GGC AGC TGG CCA-3´) and R (5´-GAT TAC GGG AGT CCA AGC-3´) were used for the identification of L.”
A taxonomic note on the genus Lactobacillus: Description of 23 novel genera, emended description of the genus Lactobacillus Beijerinck 1901, and union of Lactobacillaceae and Leuconostocaceae. (2020, neutral): “plantarum, sequencing of the recA and cpn60 genes or AFLP profiling is necessary [228, 229].”
Plantaricin MG active against Gram-negative bacteria produced by Lactobacillus plantarum KLDS1.0391 isolated from ''Jiaoke", a traditional fermented cream from China (2010, methodology): “Further identification was conducted by PCR-generated DNA banding patterns obtained with species-specific primers for Lb. plantarum, Lactobacillus pentosus and Lactobacillus paraplantarum as described by Torriani, Felis, and Dellaglio (2001).”