Mitochondrial tumour suppressors: a genetic and biochemical update

By Eyal Gottlieb, Ian Tomlinson. Nature Reviews. Cancer, 2005

647 citations recorded by the source corpus.

View Paper: https://www.semanticscholar.org/paper/c54cf74ce2b1a8e47f3627cbc168c529293e613d

How researchers see this paper

The researchers whose trusted networks rank it highest, strongest advocate first. Every researcher gets a different order.

E. White
C. V. Dang
S. Weinberg
J. Cantor
W. Wheaton
Joshua D. Rabinowitz
Jurre J. Kamphorst
F. Weinberg

Citations in the corpus

Mitochondrial metabolism and ROS generation are essential for Kras-mediated tumorigenicity (2010, methodology): “The pSiren retroviral vector (Clontech) was used to express short hairpin RNA (shRNA) sequences for the Rieske Fe-S (5’AAGGTGCCTGACTTCTCTGAA -3’) (5).”
Tumor cell metabolism: cancer's Achilles' heel. (2008, background): “succinate, which competitively inhibit the a-ketoglutaratedependent HIF-1a prolyl hydroxylase, the enzyme that usually targets HIF-1a for destruction in an oxygen-dependent fashion (Gottlieb and Tomlinson, 2005).”
SIRT3 opposes reprogramming of cancer cell metabolism through HIF1α destabilization (2011, background): “For example, gain- or loss-of-function mutations in tricarboxylic acid (TCA) cycle enzymes regulate HIF1 activity and promote carcinogenesis (Gottlieb and Tomlinson, 2005; Zhao et al., 2009).”
Cancer's molecular sweet tooth and the Warburg effect. (2006, background): “Intriguingly, the subunits of the TCA cycle enzyme SDH (SDHB, SDHC, and SDHD) behave as classic tumor suppressors in pheochromocytoma or paraganglioma (2).”
Cancer Cell Metabolism: One Hallmark, Many Faces (2012, background): “Loss-of-function germline mutations in SDH and FH have been recognized for over ten years to occur in certain cases of: (i) paraganglioma and pheochromocytoma (SDH), and (ii) leiomyoma and certain cases of renal cell carcinoma (FH) (reviewed in (83)).”
Activated Ras requires autophagy to maintain oxidative metabolism and tumorigenesis. (2011, background): “…bioenergetic function (Wu et al. 2007), attributable to oncogenic mutations and activation of signaling pathways that control metabolism (Vander Heiden et al. 2009) or mutations in TCA cycle enzymes (Gottlieb and Tomlinson 2005) that promote aerobic glycolysis (Warburg effect) (Warburg 1956).”
Mitochondria in cancer cells: what is so special about them? (2008, unknown): “When mitochondrial respiration in tumor cells is downregulated, accumulation of Krebs cycle substrates might serve as a signal for stimulation of glycolysis [ 10 ].”
Oxidative Stress and Oxidative Damage in Carcinogenesis (2010, background): “While recent work has examined the link between mitochondrial-induced ROS and tumor development (Gottlieb and Tomlinson 2005; Guzy Mitogenic Oxidative stress ethanol, TCDD, lindane, dieldrin, acrylonitrile, metals et al. 2008; Ishikawa et al. 2008), the role of mitochondrial- produced ROS in tumor…”
SDHA is a tumor suppressor gene causing paraganglioma. (2010, background): “SDHD, SDHB and SDHC (SDHx) mutations cause a cascade of molecular events leading to the abnormal stabilization of hypoxia-inducible factors (HIF) under normoxic conditions (2) or pseudo-hypoxia (via inactivation of SDH, accumulation of succinate, inhibition of prolyl-4-hydroxylases and subsequent im”
Succinate dehydrogenase and fumarate hydratase: linking mitochondrial dysfunction and cancer (2006, background): “…genetic aspects of mitochondrial tumour suppressor genes have been discussed in several recent extensive reviews (Baysal, 2003; Eng et al., 2003; Favier et al., 2005; Gottlieb and Tomlinson, 2005), only a brief history of the field will be given and more current data will be covered in this review.”
An Integrated Metabolic Atlas of Clear Cell Renal Cell Carcinoma (2016, unknown): “The conversion of succinate to fumarate is catalyzed by succinate dehydrogenase (SDH), which also acts as an electron carrier in the inner membrane of the mitochondrial electron transport chain (Gottlieb and Tomlinson, 2005).”