Nuclear activators and coactivators in mammalian mitochondrial biogenesis.

By R. Scarpulla. Biochimica et Biophysica Acta, 2002

644 citations recorded by the source corpus.

Subfields: Molecular Biology, Physiology

View Paper: https://www.semanticscholar.org/paper/acb40a69fc51e9da4041f5ebed8949291610d04c

How researchers see this paper

The researchers whose trusted networks rank it highest, strongest advocate first. Every researcher gets a different order.

In Molecular Biology

In Physiology

Citations in the corpus

Role of ROS and RNS Sources in Physiological and Pathological Conditions (2016, background): “In these tissues, the increases in PGC-1𝛼 expression were associated with an increase in the expression of NRF-1 and NRF-2.”
The physiology and pathophysiology of nitric oxide in the brain. (2005, background): “These factors promote the expression of nuclear and mitochondrial genes, which are needed for mitochondrial biogenesis (Scarpulla, 2002).”
A Mitochondrial Paradigm of Metabolic and Degenerative Diseases, Aging, and Cancer: A Dawn for Evolutionary Medicine (2005, background): “ATP synthase β subunit (ATPsynβ) and cytochrome c (cytc) and the mtTFA, which regulates mtDNA transcription (92, 196).”
Control of Mitochondrial Transcription Specificity Factors (TFB1M and TFB2M) by Nuclear Respiratory Factors (NRF-1 and NRF-2) and PGC-1 Family Coactivators (2005, background): “2A, the TFB1M and TFB2M NRF-1 sites are near-perfect matches to the NRF-1 consensus and contain all of the essential nucleotides that are invariant in a large number of functional NRF-1 recognition sites (26).”
Transcriptional coactivator PGC-1α controls the energy state and contractile function of cardiac muscle (2005, background): “PPARγ coactivator-1α (PGC-1α) and -β are potent transcriptional coactivators of nuclear receptors and other transcription factors (Knutti and Kralli, 2001; Puigserver and Spiegelman, 2003; Scarpulla, 2002).”
Exercise induces transient transcriptional activation of the PGC‐1α gene in human skeletal muscle (2003, background): “The NRF transcription factors are thought to play a critical role in the activation of mitochondrial biogenesis (Scarpulla, 2002).”
Sirtuin Regulation of Mitochondria - Energy Production, Apoptosis, and Signaling (2010, background): “These highly dynamic organelles have the ability to change their function, morphology and number in response to physiological conditions and stressors such as diet, exercise, temperature, and hormones [4].”
Transcriptional regulatory circuits controlling mitochondrial biogenesis and function. (2004, background): “More recently, PGC-1 was found to coactivate the orphan nuclear receptors ERR and ERR (Huss et al. 2002; Schreiber et al. 2003).”
PGC-1 coactivators: inducible regulators of energy metabolism in health and disease. (2006, background): “NRF-1 and NRF-2 also control the expression of nuclear genes encoding respiratory chain subunits and other proteins required for mitochondrial function (16, 17).”
Impact of aerobic exercise training on age-related changes in insulin sensitivity and muscle oxidative capacity. (2003, background): “AF106698) forward primer: AGATCGCCCTACAGCCGTC, reverse primer: TCTTCAGCCT CTCGTGCTGA, probe: ATTCCTCGTAGCTGTCATACCTGGGC; TFAM (GenBank accession no.”