Comparison of the release of adipokines by adipose tissue, adipose tissue matrix, and adipocytes from visceral and subcutaneous abdominal adipose tissues of obese humans.

By John Fain, A. Madan, M. Lloyd Hiler, Paramjeet S Cheema, S. Bahouth, Pharmacology. Endocrinology, 2004

1,655 citations recorded by the source corpus.

Subfields: Endocrine and Autonomic Systems, Epidemiology, Physiology

View Paper: https://www.semanticscholar.org/paper/2803672756944030c408a584398d8f344c8a7121

How researchers see this paper

The researchers whose trusted networks rank it highest, strongest advocate first. Every researcher gets a different order.

In Endocrine and Autonomic Systems

1. P. Trayhurn
2. I. Wood
3. P. Scherer
4. Luigi Fontana
5. A. Moschen
6. Barry M. Popkin

In Epidemiology

1. P. Trayhurn
2. P. Scherer
3. M. Trujillo
4. A. Moschen
5. I. Wood
6. J. Bastard
7. S. Klein
8. A. Kaser

In Physiology

1. P. Trayhurn
2. M. Trujillo
3. A. Moschen
4. I. Wood
5. M. Qatanani
6. P. Scherer
7. Rosa Krajmalnik-Brown
8. A. Kaser

Citations in the corpus

• Visfatin, an Adipocytokine with Proinflammatory and Immunomodulating Properties1 (2007, background): “Hs_IL-6 (NM_000600) GGTACATCCTCGACGGCATCT AGCCCTGAGAAAGGAGACATGTAACAAGAGTAACA((2)) GTGCCTCTTTGCTGCTTTCAC”
• Leptin and Obesity: Role and Clinical Implication (2021, background): “Furthermore, leptin secretion is higher in subcutaneous than in visceral adipose tissue (46, 47).”
• Visceral Fat Adipokine Secretion Is Associated With Systemic Inflammation in Obese Humans (2007, result): “These data are consistent with previous ex vivo findings that IL-6 secretion is greater in omental than in subcutaneous adipose tissue samples (16,17).”
• Reduction of macrophage infiltration and chemoattractant gene expression changes in white adipose tissue of morbidly obese subjects after surgery-induced weight loss. (2005, methodology): “The important role of the SVF in immunity and inflammatory processes (38) was confirmed by our automated procedure of annotation.”
• Effects of Gut Microbes on Nutrient Absorption and Energy Regulation (2012, background): “Adipocytes have an important role in obesity as a source of hormones, such as leptin and adiponectin.(81) Adipocytes sense the increase of SCFA levels produced by intestinal microbe fermentation and respond by inducing leptin production.”
• Psoriasis and systemic inflammatory diseases: potential mechanistic links between skin disease and co-morbid conditions. (2010, background): “Thrombospondin-1 activates transforming growth factor-b, which regulates plasminogen activator inhibitor-1 production also by adipocytes as well as hepatocytes and endothelial cells (Fain et al., 2004).”
• Mechanism linking diabetes mellitus and obesity (2014, background): “Furthermore, abdominal fat is considered more lipolytic than subcutaneous fat, and it also does not respond easily to the antilipolytic action of insulin, which makes intraabdominal fat more important in causing insulin resistance, and thus diabetes.(27,28) Marcial et al(29) further explained the mo”
• Relationship between adipocyte size and adipokine expression and secretion. (2007, background): “In a recent study by Fain and co-workers (67), IL-10 was found to be released by cultured adipose tissue pieces, but the secretion of IL-10 was largely attributed to the nonadipocyte fraction of adipose tissue.”
• Adipokines: the missing link between insulin resistance and obesity. (2008, background): “[66] Fain JN, Madan AK, Hiler ML, Cheema P, Bahouth W.”
• Recent advances in the relationship between obesity, inflammation, and insulin resistance. (2006, background): “It is lower in VAT than in SAT [72].”
• Adipokines: inflammation and the pleiotropic role of white adipose tissue (2004, background): “…the secretion of TNFa is reported to be mainly due to the cells of the stromal vascular and matrix fractions, including the macrophages, despite the fact that previously most of the mRNA for TNFa was thought to be found within the adipocytes themselves (Weisberg et al. 2003; Fain et al. 2004a).”