Stable suppression of gene expression by RNAi in mammalian cells

By Patrick J. Paddison, Amy A. Caudy, Gregory J. Hannon. Proceedings of the National Academy of Sciences of the United States of America, 2002

604 citations recorded by the source corpus.

Subfields: Molecular Biology, Plant Science

View Paper: https://www.semanticscholar.org/paper/1ec33909e586541a14d0dcb2a22d4ae942d5f45c

How researchers see this paper

The researchers whose trusted networks rank it highest, strongest advocate first. Every researcher gets a different order.

In Molecular Biology

1. Gregory J. Hannon
2. Scott M. Hammond
3. P. Schumacker
4. Phillip A. Sharp
5. R. Guzy
6. Mike Myers
7. Amy A. Caudy
8. Michael T. McManus

In Plant Science

1. Gregory J. Hannon
2. Mike Myers
3. Scott M. Hammond
4. Amy A. Caudy
5. Phillip A. Sharp
6. T. Jenuwein
7. Phillip D. Zamore
8. Olivier Voinnet

Citations in the corpus

• Dicer-deficient mouse embryonic stem cells are defective in differentiation and centromeric silencing. (2005, background): “2001), as well as to the results of functional analysis of Dicer activity in mammalian cells by knock-down experiments (Hutvagner et al. 2001; Paddison et al. 2002b; Lee et al. 2003).”
• Fragile X-related protein and VIG associate with the RNA interference machinery. (2002, background): “elegans (Grishok et al. 2000; Bernstein et al. 2001a; Hammond et al. 2001a; Paddison et al. 2002; Tabara et al. 2002) and as a means to identify components of the RNAi machinery in worms (Dudley et al.”
• Gene silencing in mammals by small interfering RNAs (2002, background): “In mammals, this has been accomplished in mouse embryonic stem (ES) cell”
• Structural variations and stabilising modifications of synthetic siRNAs in mammalian cells. (2003, background): “In the past, repression of genes by long dsRNAs has been less successful in mammalian cells with the exception of embryonic cells (5,6).”
• Phosphorylation-Dependent Ubiquitination of Cyclin D1 by the SCFFBX4-αB Crystallin Complex (2006, methodology): “Knockdown of human FBX4 was achieved by transfection with shRNA vectors (Paddison et al., 2002; Paddison and Hannon, 2002) containing either of the following target sequences: GCCGGTACAGTGTGATTCCACAGATTCAA; GGCATTGAGTGGATTCTTGAAGAAGTGGA.”
• Mitochondrial complex III is required for hypoxia-induced ROS production and cellular oxygen sensing. (2005, background): “Subsequently, 143B cells were stably transfected with other short-hairpin RNA (shRNA) oligonucleotides targeted to six different regions of human RISP mRNA (Figure S2A; Paddison et al., 2002).”