Ingestion of bacterially expressed dsRNAs can produce specific and potent genetic interference in Caenorhabditis elegans.

By L. Timmons, D. Court, Andrew Fire. Gene, 2001

1,859 citations recorded by the source corpus.

Genetic interference mediated by double-stranded RNA (RNAi) has been a valuable tool in the analysis of gene function in Caenorhabditis elegans. Here we report an efficient induction of RNAi using bacteria to deliver double-stranded RNA. This method makes use of bacteria that are deficient in RNaseIII, an enzyme that normally degrades a majority of dsRNAs in the bacterial cell. Bacteria deficient for RNaseIII were engineered to produce high quantities of specific dsRNA segments. When fed to C. elegans, such engineered bacteria were found to produce populations of RNAi-affected animals with phenotypes that were comparable in expressivity to the corresponding loss-of-function mutants. We found the method to be most effective in inducing RNAi for non-neuronal tissue of late larval and adult hermaphrodites, with decreased effectiveness in the nervous system, in early larval stages, and in males. Bacteria-induced RNAi phenotypes could be maintained over the course of several generations with continuous feeding, allowing for convenient assessments of the biological consequences of specific genetic interference and of continuous exposure to dsRNAs.

Subfields: Aging, Molecular Biology

View Paper: https://www.semanticscholar.org/paper/043b1e4f6083f2eb28ea50313f2c59f6ccd21594

How researchers see this paper

The researchers whose trusted networks rank it highest, strongest advocate first. Every researcher gets a different order.

In Aging

In Molecular Biology

Citations in the corpus

Ingested double-stranded RNAs can act as species-specific insecticides. (2009, background): “In nematodes and flatworms, ingested dsRNA results in systemic RNAi, as the dsRNA spreads to adjacent tissues (Timmons et al., 2001; Newmark et al., 2003).”
Compartment-specific perturbation of protein handling activates genes encoding mitochondrial chaperones (2004, neutral): “Interference with gene function by RNAi followed an established protocol (Timmons et al., 2001).”
Systematic functional analysis of the Caenorhabditis elegans genome using RNAi (2003, background): “Analysis of gene functions by RNAi Loss-of-function RNAi phenotypes can be generated efficiently by feeding worms with bacteria expressing double-stranded RNA (dsRNA) that is homologous to a target gen”
Loss of the putative RNA-directed RNA polymerase RRF-3 makes C. elegans hypersensitive to RNAi. (2002, neutral): “Unfortunately, RNAi genes and transgenic reporter genes can show partial does not inhibit all genes [2, 3]. We show that loss of resistance to RNAi in the nervous system [5, 6 ]. For a function of a putative RNA-directed RNA polymerase”
Chapter Five – Progress Towards RNAi-Mediated Insect Pest Management (2014, background): “sion in the nematode, Caenorhabditis elegans, (Timmons and Fire, 1998; Timmons et al., 2001) offered hope that the oral delivery of dsRNA could modulate gene expression in other invertebrates, including insects, for the purpose of pest management.”
Regulation of longevity in Caenorhabditis elegans by heat shock factor and molecular chaperones. (2003, methodology): “Plasmids containing the appropriate trigger sequence or vector L4440 alone were transformed into Escherichia coli strain HT115(DE3) by using standard methods.”
A Functional Link between the Histone Demethylase PHF8 and the Transcription Factor ZNF711 in X-Linked Mental Retardation (2010, neutral): “The lack of PHF8 binding to all H3K4me3-positive genes and differential binding to H3K4me3-positive binding indicates that other factors influence PHF8 recruitment.”
Perspectives for nano-biotechnology enabled protection and nutrition of plants. (2011, neutral): “elegans, feeding of bacteria expressing dsRNA or even soaking in dsRNA solution was followed, that is not practical for field application (Tabara et al., 1998;Timmons et al., 2001; Tomoyasu and Denell, 2004).”
RAS is regulated by the let-7 microRNA family. (2005, methodology): “RNAi methods were standard feeding procedures using synchronized L1s (Timmons et al., 2001).”
Analysis of the C. elegans Argonaute family reveals that distinct Argonautes act sequentially during RNAi. (2006, methodology): “…produced using forward primer ATGTTTCAAAAAAAGTTATGG CC and reverse primer GAAAAAGAATGAATGAACTGC at a 5 mg/ml concentration, along with the marker plasmid pTG96 (Yochem et al., 1998) at 100 mg/ml. RNAi Experiments RNAi was carried out as previously reported (Fire et al., 1998; Timmons et al., 2001).”