MOODS: fast search for position weight matrix matches in DNA sequences

By A. Quinlan, Janne H. Korhonen, Ira M. Hall, Petri Martinmäki, Cinzia Pizzi, Pasi Rastas, E. Ukkonen. 2009

7,583 citations recorded by the source corpus.

Motivation: Testing for correlations between different sets of genomic features is a fundamental task in genomics research. However, searching for overlaps between features with existing web-based methods is complicated by the massive datasets that are routinely produced with current sequencing technologies. Fast and flexible tools are therefore required to ask complex questions of these data in an efficient manner. Results: This article introduces a new software suite for the comparison, manipulation and annotation of genomic features in Browser Extensible Data (BED) and General Feature Format (GFF) format. BEDTools also supports the comparison of sequence alignments in BAM format to both BED and GFF features. The tools are extremely efficient and allow the user to compare large datasets (e.g. next-generation sequencing data) with both public and custom genome annotation tracks. BEDTools can be combined with one another as well as with standard UNIX commands, thus facilitating routine genomics tasks as well as pipelines that can quickly answer intricate questions of large genomic datasets. Availability and implementation: BEDTools was written in C++. Source code and a comprehensive user manual are freely available at http://code.google.com/p/bedtools Contact: aaronquinlan@gmail.com; imh4y@virginia.edu Supplementary information: Supplementary data are available at Bioinformatics online.

Subfields: Genetics, Molecular Biology

How researchers see this paper

The researchers whose trusted networks rank it highest, strongest advocate first. Every researcher gets a different order.

In Genetics

In Molecular Biology

Citations in the corpus

Impact of cytosine methylation on DNA binding specificities of human transcription factors (2017, positive): “Top scoring 300,000 sites recognized by each motif were searched from the human or mouse genome using programMOODS (77) with P value cut-off of 10 and score cut-off of 5.”
Codon identity regulates mRNA stability and translation efficiency during the maternal‐to‐zygotic transition (2016, neutral): “The fragment sequences spanning the full locus delineated by each pair of reads were extracted using SAMtools and BEDTools (Li et al, 2009; Quinlan & Hall, 2010).”
Complex multi-enhancer contacts captured by Genome Architecture Mapping (GAM) (2017, neutral): “Ultrathin cryosections were cut using an Leica ultracryomicrotome (UltraCut UCT 52 with EM FCS cryounit; Leica Microsystems, Milton Keynes, UK) at ~220 nm thickness, captured on sucrose-PBS drops and transferred to 1mm PEN membrane covered glass slides for laser microdissection (Leica, Milton Keynes”
Sequence Analysis (2020, positive): “Results on simulated and real human data show that cloudrnaSPAdes is able to accurately reconstruct full-length transcript sequences from read clouds having coverage as low as 1 (cid:2) , including genes with dozens of different expressed isoforms.”
Major impacts of widespread structural variation on gene expression and crop improvement in tomato (2020, neutral): “First, for each accession, we calculated short-read coverage in non-overlapping 200bp windows of the reference genome using bedtools (Quinlan and Hall, 2010).”
RNA-methylation-dependent RNA processing controls the speed of the circadian clock. (2013, positive): “For filtering rRNA and tRNA, BEDtools package (Quinlan and Hall, 2010) was used with rRNA and tRNA annotations downloaded from UCSC table browser was used.”
LncRNA-Dependent Mechanisms of Androgen Receptor-regulated Gene Activation Programs (2013, neutral): “Peak intersection was computed by using intersectBed in BedTools 24 , after extending the peaks with 1kb.”
Tracking Cancer Evolution Reveals Constrained Routes to Metastases: TRACERx Renal (2018, neutral): “Matched tumour and normal aligned sequencing files (BAM format) for the MSK cohort were obtained directly from the authors (Becerra et al., 2017) and were then converted into FASTQ format files using bam2fastq in bedtools package (Quinlan and Hall, 2010).”
β-Glucan Reverses the Epigenetic State of LPS-Induced Immunological Tolerance (2016, neutral): “…5′ GCATTGGGGGTGTTATCTCTG 3′ This paper N/A Primer LAMP1: F 5′ TGAACAAGACAGGCCTTCCC 3′R 5′ TGTGCAGCTCCAGAGTCACC 3′ This paper N/A Software and Algorithms Bedtools (Quinlan and Hall, 2010) http://bedtools.readthedocs.io/en/latest/ Bamtools (Barnett et al., 2011)…”