A genetic screen implicates miRNA-372 and miRNA-373 as oncogenes in testicular germ cell tumors.

By P. Voorhoeve, C. Sage, Mariette Schrier, A. Gillis, H. Stoop, Remco Nagel, Ying-Poi Liu, Josyanne van Duijse, J. Drost, A. Griekspoor and 6 more. Cell, 2006

1,287 citations recorded by the source corpus.

Endogenous small RNAs (miRNAs) regulate gene expression by mechanisms conserved across metazoans. While the number of verified human miRNAs is still expanding, only few have been functionally annotated. To perform genetic screens for novel functions of miRNAs, we developed a library of vectors expressing the majority of cloned human miRNAs and created corresponding DNA barcode arrays. In a screen for miRNAs that cooperate with oncogenes in cellular transformation, we identified miR-372 and miR-373, each permitting proliferation and tumorigenesis of primary human cells that harbor both oncogenic RAS and active wild-type p53. These miRNAs neutralize p53-mediated CDK inhibition, possibly through direct inhibition of the expression of the tumor-suppressor LATS2. We provide evidence that these miRNAs are potential novel oncogenes participating in the development of human testicular germ cell tumors by numbing the p53 pathway, thus allowing tumorigenic growth in the presence of wild-type p53.

Subfields: Cancer Research, Molecular Biology

View Paper: https://www.semanticscholar.org/paper/5dd77cb570ff1ad8cedfae66a8d89a17b44986c9

How researchers see this paper

The researchers whose trusted networks rank it highest, strongest advocate first. Every researcher gets a different order.

In Cancer Research

In Molecular Biology

Citations in the corpus

Senescence impairs successful reprogramming to pluripotent stem cells. (2009, background): “(Ctrl: corresponds to miR-Vec-Ctrl, which contains a stuffer DNA derived from the first 211 nt of hTR (Voorhoeve et al., 2006).”
Transactivation of miR-34a by p53 broadly influences gene expression and promotes apoptosis. (2007, background): “Although bona fide miR-34a targets that are not affected at the level of mRNA abundance will be missed by this approach, other groups have employed this strategy successfully to identify miRNA targets (Krutzfeldt et al., 2005;Lim et al., 2005;Voorhoeve et al., 2006).”
RNA-binding protein Dnd1 inhibits microRNA access to target mRNA. (2007, methodology): “Primers for human Dnd1 were For/Rev: CT CCACAGGCACCCTGAATG / GGTGCCATAGGTCCCTGTCC; other primers were as described (Voorhoeve et al., 2006).”
MicroRNA signatures in human ovarian cancer. (2007, background): “Clear evidences indicate that miRNA polycistron mir-17-92 acts as an oncogene in lymphoma and lung cancer (15); mir-372 and mir-373 are novel oncogenes in testicular germ cell tumors by numbing p53 pathway (16); miR-155 , overexpressed in B-cell lymphomas and solid tumors, leads to the development o”
A Pleiotropically Acting microRNA, miR-31, Inhibits Breast Cancer Metastasis (2009, neutral): “However, the contributions of miR-10b, miR-21, and miR-373/520c specifically to metastasis promotion are not easily discerned because of their mitogenic and/or antiapoptotic roles (Voorhoeve et al., 2006; Ma et al., 2007; Si et al., 2007).”
Connecting microRNA genes to the core transcriptional regulatory circuitry of embryonic stem cells (2008, background): “…stem cells (Laurent et al., 2008). miRNAs in this family have been implicated in cell proliferation (O’Donnell et al., 2005; He et al., 2005; Voorhoeve et al., 2006), consistent with the impaired self-renewal phenotype observed in miRNA-deficient ES cells (Kanellopoulou et al., 2005;…”
A small piece in the cancer puzzle: microRNAs as tumor suppressors and oncogenes (2006, background): “…retroviral miRNA expression library, Agami and co-workers performed a cell-based screen to identify miRNAs that when overexpressed could substitute for p53 loss and allow continued proliferation in the context of Ras activation (Voorhoeve et al., 2006). miR-372 and miR-373 emerged from this screen.”
microRNAs as oncogenes and tumor suppressors. (2007, methodology): “…et al., 2005b Papillary thyroid carcinoma miR-221↑, miR-222↑, miR-146↑, miR-181↑ KIT He et al., 2005b; Pallante et al., 2006 Testicular germ cell tumors miR-372↑, miR-373↑ LAST2 Voorhoeve et al., 2006 a ↑ represents that the expression of the miRNAs increased in this type of cancer; ↓ represents…”
Non-coding RNAs in human disease (2011, positive): “Similar models could be used to study the potential oncogenic role of other candidates, such as miRNA-372 and miRNA-37”