Reciprocal Transcriptional Regulation of Pou5f1 and Sox2 via the Oct4/Sox2 Complex in Embryonic Stem Cells

By Joon-Lin Chew, Yuin Han Loh, Wensheng Zhang, X. Chen, W. Tam, Leng-Siew Yeap, Pin Li, Yen-Sin Ang, Bing Lim, Paul Robson and 1 more. Molecular and Cellular Biology, 2005

734 citations recorded by the source corpus.

Subfields: Molecular Biology, Public Health, Environmental and Occupational Health

View Paper: https://www.semanticscholar.org/paper/0769a38378230d0375b45420feaf80069cf295af

How researchers see this paper

The researchers whose trusted networks rank it highest, strongest advocate first. Every researcher gets a different order.

In Molecular Biology

In Public Health, Environmental and Occupational Health

S. Yamanaka

Citations in the corpus

High Resolution Genome Wide Binding Event Finding and Motif Discovery Reveals Transcription Factor Spatial Binding Constraints (2012, background): “We examined if GEM could detect pairs of transcription factors that bind to the genome with characteristic pair-wise spacing, beginning with the well-known hetero-dimeric pair Sox2-Oct4 [27].”
The Oct4 and Nanog transcription network regulates pluripotency in mouse embryonic stem cells (2006, methodology): “In further validation of the Oct4 ChIP-PET data, we found that the PET profile precisely paralleled that detected by real-time PCR on two previously characterized targets of Oct4, Pou5f1 and Nanog”
Blastocyst lineage formation, early embryonic asymmetries and axis patterning in the mouse (2009, background): “Later, the reciprocal repression of TE targets by Oct4/Sox2/Nanog in the pluripotent lineages (Loh et al., 2006; Boyer et al., 2005), combined with the known autoregulatory properties of the Oct4 (Chew et al., 2005) and Cdx genes (Xu et al., 1999; Beland et al., 2004), ensures the maintenance of lin”
Control of Embryonic Stem Cell State (2011, background): “Sites co-occupied by the three core regulators generally have enhancer activity, and transcription of genes adjacent to such sites often depends on at least one of the trio (Chen et al., 2008b; Chew et al., 2005; Matoba et al., 2006).”
Distinct factors control histone variant H3.3 localization at specific genomic regions (2010, neutral): “, 2005), Pou5f1_F: TTGGGCTAGAGAAGGATGTGGTT, Pou5f1_R: GGAAAAGGGACTGAGTAGAGTGTGG (Chew et al., 2005), Nanog_F: CCTCTTCAAGGCAGCCCTGATTCT, Nanog_R: AGAGTTCTTGCATCTGCTGGAGGCT, Olig1_F: GCTCGCCCAGGTGTTTTGT, Olig1_R: GCATGGAACGTGGTTGGAAT (Boyer et al.”
How is pluripotency determined and maintained? (2007, background): “Interestingly, both Oct3/4 and Sox2 possess enhancers that are activated by the Oct3/4-Sox2 complex in a stem-cell-specific manner (Chew et al., 2005; OkumuraNakanishi et al., 2005; Tomioka et al., 2002).”
Pluripotency governed by Sox2 via regulation of Oct3/4 expression in mouse embryonic stem cells (2007, background): “Furthermore, the Oct–Sox enhancers are important in promoting the expression of Oct3/4 and Sox2 themselves, suggesting that these two transcription factors are regulated by a positive-feedback loo”
Tet1 and Tet2 regulate 5-hydroxymethylcytosine production and cell lineage specification in mouse embryonic stem cells (2011, background): “Tet Enzymes Regulate ESC Differentiation ESCs also downregulated expression of the others because of known cross-regulatory and cooperative interactions (Chew et al., 2005; Loh et al., 2006).”
Integration of external signaling pathways with the core transcriptional network in embryonic stem cells. (2008, background): “We demonstrate that the two key signaling pathways are integrated to the Oct4, Sox2, and Nanog circuitries through Smad1 and STAT3.”
Strategies and new developments in the generation of patient-specific pluripotent stem cells. (2007, background): “Another group also reported a positive effect of KLF4 in self-renewal of mouse ES cells (Li et al., 2005).”