Telomerase in the human organism

By K. Collins, James R. Mitchell. Oncogene, 2002

624 citations recorded by the source corpus.

Subfields: Aging, Molecular Biology, Physiology

View Paper: https://www.semanticscholar.org/paper/be9457f5d35456205f5ab68f47094937c3712155

How researchers see this paper

The researchers whose trusted networks rank it highest, strongest advocate first. Every researcher gets a different order.

In Aging

1. M. Blasco

In Molecular Biology

1. M. Blasco
2. Manel Esteller
3. E. Li
4. M. Fraga
5. Yi Zhang
6. Hao Wu
7. Peter A. Jones
8. R. Weinberg

In Physiology

1. M. Blasco

Citations in the corpus

• Cellular senescence in cancer and aging. (2007, neutral): “Telomerase is a ribonucleoprotein with DNA polymerase activity that elongates telomeres (Greider and Blackburn, 1985), but its level of activity in most adult tissues is not sufficient to compensate for the progressive telomere attrition that occurs with aging (Collins and Mitchell, 2002).”
• Telomere length, stem cells and aging. (2007, background): “Interestingly, telomere attrition is observed with increasing age in all human tissues in which it has been teste”
• DNA methyltransferases control telomere length and telomere recombination in mammalian cells (2006, background): “Bisulfite sequencing Locus 5 ́primer 3 ́primer Chr1 end aaaagatggtgagtgtaggtgt tcacaatatcctcctcttcttc Chr16 end gatgggatttggaagggtatt actccctaattaactacaacccatc Chr19 start tagtgttggggtgtatataagtagt ctaaccaaccttaactacttctatc Chr19 end(1) atagaagttaagaaataaatggaggt ctctcacctattcaaactaatttc Chr19 end(2”
• Telomeres and human disease: ageing, cancer and beyond (2005, background): “They are also the substrate for telomerase, a DNA polymerase that can elongate them in those cell types in which it is expresse”
• The epigenetic regulation of mammalian telomeres (2007, background): “Telomere length is maintained by telomerase, a reverse transcriptase that adds telomeric repeats de novo after each cell division, counteracting the end-replication problem in those cell types in which it is expresse”
• RNA-binding proteins in human genetic disease. (2008, neutral): “DKC Mutations in TERC and TERT Defects in RNP telomerase activity [ 96 ] FXSa”