Analysis of the Fecal Microflora of Human Subjects Consuming a Probiotic Product Containing Lactobacillus rhamnosusDR20

By G. Tannock, K. Munro, H. Harmsen, G. Welling, J. Smart, P. Gopal. Applied and Environmental Microbiology, 2000

700 citations recorded by the source corpus.

Subfields: Food Science, Molecular Biology, Nutrition and Dietetics

View Paper: https://www.semanticscholar.org/paper/9c17cd780134931498e0a3c7ae8fbb4bdba16c1d

How researchers see this paper

The researchers whose trusted networks rank it highest, strongest advocate first. Every researcher gets a different order.

In Food Science

In Molecular Biology

In Nutrition and Dietetics

Citations in the corpus

Targeting the Microbiota-Gut-Brain Axis: Prebiotics Have Anxiolytic and Antidepressant-like Effects and Reverse the Impact of Chronic Stress in Mice. (2017, positive): “microbiota has principally been exploited to yield positive effects on brain health via probiotics with various bifidobacteria and lactobacilli strains shown to have anxiolytic and pro-cognitive effects in both rodents (7-10) and humans (11-14).”
Changes in Gut Microbiota Control Metabolic Endotoxemia-Induced Inflammation in High-Fat Diet–Induced Obesity and Diabetes in Mice (2008, methodology): “Bacterial RNA was amplified by RT-PCR targeting the V3 region of the 16S rRNA gene and using the universal bacterial primers HDA1-GC and HDA2 and a previously described program (14) (HDA1-GC, 5 -CGCCCGGGGCGC GCCCCGTGGCGGGGCGGGGGCGCGGGGGGACTCCTACGGGAGGCAGCAGT; and HDA2, 5 -GTATTACCGCGGCTGCTGGCAC-3 ).”
Mucosa-Associated Bacteria in the Human Gastrointestinal Tract Are Uniformly Distributed along the Colon and Differ from the Community Recovered from Feces (2002, background): “Such studies revealed that the predominant bacterial community in mammalian feces is stable in time, host specific, affected by ageing, and not altered after consumption of certain probiotic strains (11, 21, 24, 25, 28, 29).”
Moving pictures of the human microbiome (2011, background): “…our observations paint a picture of a human microbiome that is highly variable over time (Figures 2 and 3; Additional files 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15), but from which stable patterns of similarities and differences among body habitats and individuals emerge (Figure 1).”
Revised Estimates for the Number of Human and Bacteria Cells in the Body (2016, methodology): “Later experiments (Franks et al., 1998; Harmsen et al., 2002; Tannock et al., 2000; Thiel and Blaut, 2005) used DAPI staining and FISH (fluorescent in situ hybridization).”
Intestinal microbiota in human health and disease: the impact of probiotics (2011, neutral): “…L. rhamnosus DR20 Faeces Conventional culturing FISH DGGE Probiotic-treated group: No significant effect on dominant microbiota composition Tannock et al. (2000) Healthy adults (n = 30) Probiotic: B. animalis subsp. lactis Bb-12 Prebiotic: GOS Synbiotic: GOS and B. animalis subsp. lactis…”
Resistant Starches Types 2 and 4 Have Differential Effects on the Composition of the Fecal Microbiota in Human Subjects (2010, neutral): “bacterial taxa were selected as they were included in previous studies that concerned the effect pre- and probiotics on the human fecal microbiota, and enterococci and enterobacteria cannot be detected by pyrosequencing as they constitute a minor fraction of the total microbial community in the huma”
Molecular Monitoring of Succession of Bacterial Communities in Human Neonates (2002, methodology): “These methods are especially valuable for monitoring shifts in community structure that occur in response to environmental perturbations, such as diet (29, 32, 38).”
Fecal microbiota transplantation and emerging applications (2012, background): “reported the durable persistence of donor flora at 24 weeks post-transplantation; by comparison, oral probiotics have been shown to persist in the gut microbiota once consumption has ceased; however, they rarely persist beyond 14 days”
VSL#3 Probiotic-Mixture Induces Remission in Patients with Active Ulcerative Colitis (2005, positive): “and HDA2, as described previously (36) and the Taq PCR”
Probiotic use in clinical practice: what are the risks? (2006, methodology): “There was also an increase in lactobacilli and a decrease in the proportion of the fecal microflora represented by Clostridium spp. Tannock et al (65) used molecular methods to analyze stool bacterial populations and found less marked changes in the adult fecal microflora during supplementation with”