Delineation of a CpG Phosphorothioate Oligodeoxynucleotide for Activating Primate Immune Responses In Vitro and In Vivo1

By G. Hartmann, R. Weeratna, Z. Ballas, P. Payette, S. Blackwell, I. Suparto, W. Rasmussen, M. Waldschmidt, D. Sajuthi, R. Purcell and 2 more. Journal of Immunology, 2000

633 citations recorded by the source corpus.

Subfields: Immunology, Molecular Biology

View Paper: https://www.semanticscholar.org/paper/621cbfac0010328382b9712f520fdeb062cc071d

How researchers see this paper

The researchers whose trusted networks rank it highest, strongest advocate first. Every researcher gets a different order.

In Immunology

1. V. Hornung
2. Rafi Ahmed
3. G. Hartmann
4. Shizuo Akira
5. E. Wherry
6. S. Kaech
7. Bali Pulendran

In Molecular Biology

1. V. Hornung
2. Rafi Ahmed

Citations in the corpus

• Quantitative Expression of Toll-Like Receptor 1–10 mRNA in Cellular Subsets of Human Peripheral Blood Mononuclear Cells and Sensitivity to CpG Oligodeoxynucleotides1 (2002, methodology): “However, there has been controversy over whether this activation is direct (20) or indirect (12, 18).”
• Cutting Edge: Role of Toll-Like Receptor 9 in CpG DNA-Induced Activation of Human Cells1 (2001, neutral): “Sequences of the ODN (5 33 ) were: K3 CpG ODN, ATCGACTCTCGAGCGTTCTC; K3-flip control ODN, ATGCACTCTGCAGGCTTCTC; K3-methyl, ATmCGAC TCTmCGAGmCGTTCTC; 2006, TCGTCGTTTTGTCGTTTTGCTGTT (11); 1466, TCAACGTTGA; 1555, GCTAGACGTTAGCGT; and 1612, GCTAGATGTTAGCGT, wheremC indicates a methyl cytosine.”
• Cutting Edge: Long-Term B Cell Memory in Humans after Smallpox Vaccination 1 (2003, methodology): “PBMC were plated in 24-well dishes at 5 10(5) cells/well in R-10 supplemented with a mix of polyclonal mitogens: 1/100,000 pokeweed mitogen extract (made at Emory University), 6 g/ml phosphothioated CpG ODN-2006 (12), and 1/10,000 Staphylococcus aureus Cowan (Sigma-Aldrich, St.”