DNA barcoding Australia's fish species

By R. Ward, Tyler S. Zemlak, B. H. Innes, P. Last, Paul D. N. Hebert. Philosophical Transactions of the Royal Society B: Biological Sciences, 2005

4,282 citations recorded by the source corpus.

Subfields: Aquatic Science, Molecular Biology, Nature and Landscape Conservation

View Paper: https://www.semanticscholar.org/paper/25c065e3089cd1519bcccf372639ee2e17efdf86

How researchers see this paper

The researchers whose trusted networks rank it highest, strongest advocate first. Every researcher gets a different order.

In Aquatic Science

In Molecular Biology

In Nature and Landscape Conservation

Citations in the corpus

DNA barcoding reveals a high incidence of fish species misrepresentation and substitution on the South African market (2012, background): “Although barcode data from BOLD and GenBank are continuously exchanged, a possible reason for this finding is that the BOLD database currently contains a wider representation of COI sequences with which unknown specimens can be compared (Wong & Hanner, 2008).”
DNA barcoding detects market substitution in North American seafood (2008, neutral): “GGCCAGTCAACCAACCACAAAGACATTGGCAC3’ (Ward et al., 2005)”
A DNA Sequence–Based Approach To the Identification of Shark and Ray Species and Its Implications for Global Elasmobranch Diversity and Parasitology (2012, background): “Nonetheless, to facilitate comparisons with BOLD Systems-based studies (e.g., Ward et al., 2005; Ward and Holmes, 2007; Ward et al., 2007, 2008, 2009), intraspecific K2P distances (appendix 1) and intrageneric K2P distances (table 3), as calculated in BOLD, were also computed.”
Universal primer cocktails for fish DNA barcoding (2007, result): “It is worth noting that NUMTs are rarely problematic in fishes (Bensasson et al. 2001; Richly & Leister 2004; Venkatesh et al. 2006 ), a conclusion reinforced in our study where we routinely recovered a single amplicon that showed the sequence characteristics expected of authentic COI.”
Barcoding's next top model: an evaluation of nucleotide substitution models for specimen identification (2012, background): “Base frequencies are assumed to be equal under thismodel, but departures from this assumption are common in real data sets, and different nucleotide compositions may influence particular types of substitution rate (Tamura 1992; Galtier & Gouy 1995; Ward et al. 2005).”
Impact of DNA sequence-data on the taxonomy of anamorphic fungi (2007, background): “…from animal lineages have been encouraging as evident from the results where more than 95% species-level resolution was provided in most cases (Ward et al., 2005; Smith et al., 2005; Hajibabaei et al., 2006), and while in a few cases the incomplete resolution revealed existence of new species…”
The promise of DNA barcoding for taxonomy. (2005, background): “Based on past results for varied animal groups, DNA barcoding will deliver species-level resolution in 95% to 97% of cases (Hebert et al., 2004b; Janzen et al., 2005; Ward et al., 2005).”
New insights on early evolution of spiny-rayed fishes (Teleostei: Acanthomorpha) (2014, methodology): “Three commonly used mitochondrial loci were also used in the analysis (COI, Cytochrome Oxidase subunit I gene; 12 and 16S, two subunit mitochondrial ribosomal RNA genes) (Kocher et al., 1989; Palumbi et al., 1991; Ward et al., 2005).”
DNA barcoding reveals new insights into the diversity of Antarctic species of Orchomene sensu lato (Crustacea: Amphipoda: Lysianassoidea) (2011, background): “In several animal taxa, the effectiveness of this approach has been confirmed, such as in birds (Hebert et al., 2004b), fish (Ward et al., 2005), molluscs (Meyer and Paulay, 2005), spiders (Barrett and Hebert, 2005) and several groups of butterflies (Hebert et al., 2004a; Janzen et al., 2005;…”
Recent advances in DNA taxonomy (2007, methodology): “... steep transition from low branching rates throughout most of the tree, to very fast branching rates near the tips (Fig. 2). This shift can be interpreted as a change from phylogenetic branching (macroevolution) to population-level processes (microevolution), and can be described, respectively, w”
A universal DNA mini-barcode for biodiversity analysis (2008, background): “The 650 bp mitochondrial cytochrome c oxidase 1 (CO1, cox1) DNA barcode [2] is easily sequenced and provides greater than 97% species-level specificity for birds [3], mammals [4], fishes [5], and various arthropods [6].”