Use of 16S rRNA Gene-Targeted Group-Specific Primers for Real-Time PCR Analysis of Predominant Bacteria in Human Feces
By T. Matsuki, Koichi Watanabe, J. Fujimoto, T. Takada, R. Tanaka. Applied and Environmental Microbiology, 2004
691 citations recorded by the source corpus.
Subfields: Epidemiology, Infectious Diseases, Molecular Biology
View Paper: https://www.semanticscholar.org/paper/0603236072c28a18d073fb6270d71ee110accf0b
How researchers see this paper
The researchers whose trusted networks rank it highest, strongest advocate first. Every researcher gets a different order.
In Epidemiology
In Infectious Diseases
In Molecular Biology
Citations in the corpus
- Metal Oxide Nanoparticles Induce Minimal Phenotypic Changes in a Model Colon Gut Microbiota (2015, neutral): “Understanding the gut microbiome and its importance to human health with techniques such as molecular methods (Collins and Gibson, 1999; Matsuki et al. , 2004; Eckburg et al. , 2005; Armougom et al. , 2009) will give rise to more treatment and disease prevention options.”
- Through Ageing, and Beyond: Gut Microbiota and Inflammatory Status in Seniors and Centenarians (2010, background): “The thermocycling conditions and universal primers for bacteria and specific primers for Clostridium leptum group, Bifidobacterium genus, Akkermansia muciniphila, Faecalibacterium prausnitzii and for the genus Methanobrevibacter, representing a dominant archaeon in the human gut bacteria have been d”
- Influence of red wine polyphenols and ethanol on the gut microbiota ecology and biochemical biomarkers. (2012, neutral): “GGTGTTCTTCCCGATATCTACA Matsuki et al, 2002 (25) 550”
- Distinct composition of gut microbiota during pregnancy in overweight and normal-weight women. (2008, methodology): “qPCRs were conducted as previously described (18).”
- Comparative Analysis of Pyrosequencing and a Phylogenetic Microarray for Exploring Microbial Community Structures in the Human Distal Intestine (2009, positive): “Using the HITChip for comparing phylogenetic profiles of fecal microbiota from five young and five elderly adults collected at three time points, Rajilic’-Stojanovic’ and colleagues confirmed previous findings that the adult fecal microbiota is highly individual-specific and relatively stable over t”
- Gut microbiota in children with type 1 diabetes differs from that in healthy children: a case-control study (2013, methodology): “Specific primers targeting different bacterial genera were used to characterize the fecal microbiota by quantitative real-time qPCR (Table 1) [30-36].”