Detection and Identification of GastrointestinalLactobacillus Species by Using Denaturing Gradient Gel Electrophoresis and Species-Specific PCR Primers

By J. Walter, G. Tannock, A. Tilsala-Timisjärvi, S. Rodtong, D. Loach, K. Munro, T. Alatossava. Applied and Environmental Microbiology, 2000

647 citations recorded by the source corpus.

Subfields: Ecology, Food Science, Molecular Biology

View Paper: https://www.semanticscholar.org/paper/05fd3fb819b62a335a4c6cd4ffe702ed2639caea

How researchers see this paper

The researchers whose trusted networks rank it highest, strongest advocate first. Every researcher gets a different order.

In Ecology

1. W. Al-Soud
2. Koichi Watanabe
3. S. Sørensen
4. J. Walter

In Food Science

1. J. Walter
2. Koichi Watanabe
3. R. Sartor

In Molecular Biology

1. J. Walter
2. W. Al-Soud
3. Koichi Watanabe
4. S. Sørensen
5. R. Sartor
6. J. Turner

Citations in the corpus

• Resistant Starches Types 2 and 4 Have Differential Effects on the Composition of the Fecal Microbiota in Human Subjects (2010, methodology): “DNA fragments whose staining intensity changed according to dietary treatment were excised, purified as described by Walter and coworkers [58], and cloned using the TOPOH TA CloningH Kit for Sequencing (pCRH 4 TOPOH Vector) (Invitrogen).”
• Use of 16S rRNA Gene-Targeted Group-Specific Primers for Real-Time PCR Analysis of Predominant Bacteria in Human Feces (2004, background): “So far, specific oligonucleotide primers have been designed for many bacterial species known to be present in the intestinal tract (12, 18, 19, 27, 33, 34).”
• Characterization of bacterial populations in Danish raw milk cheeses made with different starter cultures by denaturating gradient gel electrophoresis and pyrosequencing (2011, methodology): “Approximately 200 bp fragment of the V3 region of the 16S rDNAwas amplified using the primers PRBA338f with a GC clamp (50CGCCCGCCGCGCGCGGCGGG CGGGGCGGGGGCACGGGGGGACTCCTACGGGAGGCAGCAG03) (Walter et al., 2000) and PRUN558r (50-ATTACCGCGGCTGCTGG-30) (Ercolini, Hill, & Dodd, 2003).”
• VSL#3 Probiotic-Mixture Induces Remission in Patients with Active Ulcerative Colitis (2005, methodology): “DNA was extracted from biopsies, the VSL#3 powder and the individual bacterial strains that make up the VSL#3 product, as described elsewhere (35).”
• Analysis of the Fecal Microflora of Human Subjects Consuming a Probiotic Product Containing Lactobacillus rhamnosusDR20 (2000, background): “It has been shown that PCR-DGGE detects alterations in the simpler microbial community in the murine stomach, in which the number of Lactobacillus cells is much higher than the number of DR20 cells in feces (27).”
• Assessment of novel probiotic Lactobacillus casei strains for the production of functional dairy foods (2004, methodology): “Nested amplification with the GC-containing universal primers HDA1-GC and HDA2 (Walter et al., 2000) permitted the separation of the DNA fragments by denaturing gradient gel electrophoresis (DGGE).”
• Reduction in diversity of the colonic mucosa associated bacterial microflora in patients with active inflammatory bowel disease (2004, background): “45 47 71 72 31 One of the species excised from the SSCP gel showed a close phylogenetic relationship to the Enterobacteriaceae group.”