Genome-wide Measurement of RNA Secondary Structure in Yeast

By Michael Kertesz, Yue Wan, E. Mazor, Johannes Rinn, R. Nutter, Howard Y. Chang, Eran Segal. Nature, 2010

766 citations recorded by the source corpus.

The structures of RNA molecules are often important for their function and regulation, yet there are no experimental techniques for genome-scale measurement of RNA structure. Here we describe a novel strategy termed parallel analysis of RNA structure (PARS), which is based on deep sequencing fragments of RNAs that were treated with structure-specific enzymes, thus providing simultaneous in vitro profiling of the secondary structure of thousands of RNA species at single nucleotide resolution. We apply PARS to profile the secondary structure of the messenger RNAs (mRNAs) of the budding yeast Saccharomyces cerevisiae and obtain structural profiles for over 3,000 distinct transcripts. Analysis of these profiles reveals several RNA structural properties of yeast transcripts, including the existence of more secondary structure over coding regions compared with untranslated regions, a three-nucleotide periodicity of secondary structure across coding regions and an anti-correlation between the efficiency with which an mRNA is translated and the structure over its translation start site. PARS is readily applicable to other organisms and to profiling RNA structure in diverse conditions, thus enabling studies of the dynamics of secondary structure at a genomic scale.

Subfields: Molecular Biology

View Paper: https://www.semanticscholar.org/paper/f3be3ab7a50ac05c57358b4637787d7424a7ef32

How researchers see this paper

The researchers whose trusted networks rank it highest, strongest advocate first. Every researcher gets a different order.

In Molecular Biology

Citations in the corpus

Genomic maps of lincRNA occupancy reveal principles of RNA-chromatin interactions (2011, methodology): “Morpholino Probes against HOTAIR were designed on three open regions detected by PARS-seq (Kertesz et al., 2010) by Gene-Tools LLC (HOTAIR Morpho-1: GAGCAGCTCAAGTCCCCTGCATCCA, HOTAIR Morpho-2: GCA CCCGCTCAGGTTTTTCCAGCGT, HOTAIR Morpho-3: TACATAAACCTC TGTTCTGTGAGTGC, Mock Morpho:…”
RNA controls PolyQ protein phase transitions (2015, background): “Moreover, secondary structure of mRNAs can influence function as has been seen with translation efficiency in yeast and other organisms (Kertesz et al., 2010; Pop et al., 2014).”
The scanning mechanism of eukaryotic translation initiation. (2014, background): “This lesser complexity may reflect, at least in part, the relatively short, unstructured 5′UTRs of most yeast mRNAs (19, 20).”
Emerging functional and mechanistic paradigms of mammalian long non-coding RNAs (2012, background): “However, an emerging technology that is referred to as parallel analysis of RNA structure (PARS), which is based on deep sequencing of RNA fragments that have been treated with structure-specific enzymes, has shown promise in predicting secondary structure of RNAs in yeast (101).”
RNA motif discovery by SHAPE and mutational profiling (SHAPE-MaP) (2014, unknown): “3b ) has not been implemented in prior massively parallel sequencing-based RNA structure analyses 5,7,8,10,11,50 ; the authors of SHAPE-seq 8 and Mod-seq 51 have independently noted the importance of read depth in obtaining quantitative RNA structure probing information.”
Genome regulation by long noncoding RNAs (2012, background): “More recently, deep sequencing of RNA fragments generated by enzymes that cleave single stranded and double stranded regions of RNA mapped the secondary structure of the entire budding yeast transcriptome, revealing several global structural properties (115).”
Roles, Functions, and Mechanisms of Long Non-coding RNAs in Cancer (2016, background): “The fragments are then reversely transcribed and compared with each other, allowing for deduction of RNA structures in vivo [105,106].”