The Antibacterial Lectin RegIII-Gamma Promotes the Spatial Segregation of Microbiota and Host in the Intestine
By J. Gern. Pediatrics, 2012
1,316 citations recorded by the source corpus.
Subfields: Endocrinology, Infectious Diseases, Pharmacology
View Paper: https://www.semanticscholar.org/paper/d2d39c7c40b3552f93ce8cbbd893f88bd3d44b1b
How researchers see this paper
The researchers whose trusted networks rank it highest, strongest advocate first. Every researcher gets a different order.
In Endocrinology
- C. Petersen
- J. Gregory Caporaso
- Ruth E. Ley
- Rob Knight
- Omry Koren
- Sara C. Di Rienzi
- David A. Relman
- Angela C. Poole
In Infectious Diseases
- Rob Knight
- Ruth E. Ley
- David A. Relman
- Omry Koren
- C. Petersen
- J. Gregory Caporaso
- Sara C. Di Rienzi
- Y. Umesaki
In Pharmacology
- C. Petersen
- J. Gregory Caporaso
- Ruth E. Ley
- Rob Knight
- Omry Koren
- Sara C. Di Rienzi
- David A. Relman
- Angela C. Poole
Citations in the corpus
- Intestinal permeability – a new target for disease prevention and therapy (2014, neutral): “For example, mouse Reg3g and HIP/PAP in humans has been reported to be bactericidal for Grampositive bacteria in vitro, and to be important in the spatial compartmentalization of microbes in the intestine [40].”
- The Gut Microbiome Modulates Colon Tumorigenesis (2013, neutral): “Relative bacterial loads in stool samples were quantified by qPCR analysis of bacterial genomic DNA using Kapa SYBR-fast master mix (Kapa biosciences) and universal 16S rRNA gene primers (F, ACTCCTACGGGAGGCAGCAGT; R, ATTACCGCGGCTG CTGGC) (49).”
- Homeostatic immunity and the microbiota (2017, neutral): “Accumulation of antimicrobial peptides in the mucus contributes to the maintenance of the segregation between the microbiota, a separation referred to as the “demilitarized zone” (Vaishnava et al., 2011).”
- Gut Immune Maturation Depends on Colonization with a Host-Specific Microbiota (2012, background): “Antimicrobial peptides constitute another critical arm of innate intestinal immunity, providing protection from bacterial penetration of the gut (Vaishnava et al., 2011).”
- Role of the Microbiota in Immunity and inflammation (2014, neutral): “…antimicrobial peptide RegIIIg not only contributes to maintenance of segregation between the microbiota and host epithelial cells, but also promotes protection against defined pathogens, such as vancomycin-resistant Enterococcus faecalis (Brandl et al., 2008; Vaishnava et al., 2008, 2011).”