The Oxylipin Signal Jasmonic Acid Is Activated by an Enzyme That Conjugates It to Isoleucine in Arabidopsis

By Paul Staswick, I. Tiryaki. The Plant Cell Online, 2004

1,113 citations recorded by the source corpus.

Despite its importance in a variety of plant defense responses, our understanding of how jasmonic acid (JA) functions at the biochemical level is limited. Several amino acid conjugates of JA were tested for their ability to complement the JA-insensitive Arabidopsis thaliana mutant jar1-1. Unlike free JA, JA-Ile inhibited root growth in jar1-1 to the same extent as in the wild type, whereas JA-Val, JA-Leu, and JA-Phe were ineffective inhibitors in both genotypes. Thin-layer chromatography and gas chromatography–mass spectrometry (GC-MS) analysis of products produced in vitro by recombinant JAR1 demonstrated that this enzyme forms JA-amido conjugates with several amino acids, including JA-Ile. JA-Val, -Leu, -Ile, and -Phe were each quantified in Arabidopsis seedlings by GC-MS. JA-Ile was found at 29.6 pmole g−1 fresh weight (FW) in the wild type but was more than sevenfold lower in two jar1 alleles. JA-Leu, -Val, and -Phe were present at only low levels in both genotypes. Expression of wild-type JAR1 in transgenic jar1-1 plants restored sensitivity to JA and elevated JA-Ile to the same level as in the wild type. The ethylene precursor 1-aminocyclopropane-1-carboxylic acid (ACC) conjugated to JA was also found in plant tissue at 18.4 pmole g−1 FW. JA-ACC was determined not be an effective jasmonate root inhibitor, and surprisingly, was twofold higher in the mutants than in the wild type. This suggests that another JA-conjugating enzyme(s) is present in Arabidopsis. Synthesis of JA-ACC might provide a mechanism to coregulate the availability of JA and ACC for conversion to the active hormones JA-Ile and ethylene, respectively. We conclude that JAR1 is a JA-amino synthetase that is required to activate JA for optimal signaling in Arabidopsis. Plant hormone activation by conjugation to amino acids and the enzymes involved in their formation were previously unknown.

Subfields: Insect Science, Plant Science

View Paper: https://www.semanticscholar.org/paper/cba27336e79f03342b653a6ff23aa70f53ea92f6

How researchers see this paper

The researchers whose trusted networks rank it highest, strongest advocate first. Every researcher gets a different order.

In Insect Science

1. C. Wasternack
2. Martin Heil
3. G. Howe
4. C. Pieterse
5. S. He
6. Susheng Song
7. Ian T. Baldwin
8. B. Hause

In Plant Science

1. C. Wasternack
2. Martin Heil
3. C. Pieterse
4. S. He
5. G. Howe
6. P. Bakker
7. L. C. van Loon
8. Saskia C. M. Van Wees

Citations in the corpus

• Derepression of ethylene-stabilized transcription factors (EIN3/EIL1) mediates jasmonate and ethylene signaling synergy in Arabidopsis (2011, background): “Yeast two-hybrid pGADT7 EIN3 (1-300) BamH1 EIN3-1 CGGGATCCTCATGATGTTTAATGAGATG”
• Jasmonates counter plant stress: A Review (2015, background): “The carboxylic acid side-chain of JA can be conjugated to the precursor of ethylene namely 1-amino cyclopropane-1-carboxylic (ACC) (Staswick and Tiryaki, 2004).”
• Plant Defense Signaling and Responses Against Necrotrophic Fungal Pathogens (2016, positive): “The enzyme jasmonoyl isoleucine conjugate synthase 1 which is encoded by jar1 gene converts JA into JA-Ile, which is a bioactive derivative in JA signaling (Staswick and Tiryaki 2004; Thines and others 2007; Katsir and others 2008).”
• Role of stomata in plant innate immunity and foliar bacterial diseases. (2008, background): “In particular, COR is most similar to JA conjugated to the amino acid isoleucine (JA-Ile; Figure 6) (61,99).”
• Contrasting mechanisms of defense against biotrophic and necrotrophic pathogens. (2005, background): “JAR1 encodes a JA-amino synthetase that can form conjugates between JA and several amino acids including isoleucine (105, 106).”
• Direct Defenses in Plants and Their Induction by Wounding and Insect Herbivores (2008, background): “JA-Ile by JAR1 (Staswick and Tiryaki 2004).”
• Jasmonate Biosynthesis, Perception and Function in Plant Development and Stress Responses (2013, background): “Since jasmonoyl-L-isoleucine (JA-Ile) is the only one bioactive ligand, known so far, involving in JA signaling, JAR1 (JASMONATE RESISTANT 1), a JA amino acid synthetase that conjugates isoleucine to JA (Staswick and Tiryaki, 2004), was assumed a most important JA derivation enzyme in plants.”
• Indirect defence via tritrophic interactions. (2008, background): “…signalling pathway (Krumm et al., 1995), JA-Ile is now discussed to interact with COI1 and thereby to directly induce jasmonate-responsive genes (Staswick & Tiryaki, 2004), and volicitin is an amino acid conjugate of linolenic acid (i.e. the fatty acid that forms the starting point of the…”
• Multitrophic interactions below and above ground: en route to the next level (2011, background): “…DEFENCES Herbivore-induced responses can trigger the production of several signalling molecules that are transported throughout the plant and then cause increases in the content of defensive compounds sensu strictu in as yet undamaged parts of the plant (Staswick & Tiryaki 2004; Heil & Ton 2008).”
• Plant immunity to insect herbivores. (2008, background): “The recent discovery (121) that JA is conjugated to the ethylene precursor 1-aminocyclopropane-1-carboxylic acid (ACC) is of interest because JA and ethylene accumulate simultaneously and act synergistically in response to herbivory (49, 111, 138).”
• Jasmonates: an update on biosynthesis, signal transduction and action in plant stress response, growth and development. (2007, background): “(1) Formation of amino acid conjugates by a JA conjugate synthase (JAR1) (Staswick and Tiryaki, 2004) upon adenylation at the carboxylic acid side-chain of JA by the AMP-transferase activity of JAR1.”
• (+)-7-iso-Jasmonoyl-L-isoleucine is the endogenous bioactive jasmonate. (2009, background): “, JA–amino acid conjugation by JAR1 (Jasmonate-Resistant 1) is necessary for JA activation, and (−)-JA- L -isoleucine ( 6 ) was recently demonstrated to be the molecularly active form of the hormon”
• Jasmonates and Related Compounds in Plant-Insect Interactions (2004, background): “The recent identification of JAR1 as a JAamino acid conjugate synthetase, which activates JA for conjugation to isoleucine (Staswick and Tiryaki 2004), demonstrates that JA-Ile and the activation of JA is not necessary for the elicitation of herbivore resistance in Arabidopsis.”
• Biogenic volatile organic compounds in the Earth system. (2009, background): “Staswick & Tiryaki (2004) have suggested that an unknown enzyme might be responsible for conjugation between JA and ACC, leading to an inactive JA–ACC conjugate, with subsequent hydrolysis of such a conjugate yielding JA and ACC available for the corresponding signalling routes.”
• Metabolism and Plant Hormone Action During Clubroot Disease (2009, background): “Significant for this finding is the expression of JAR1, a member of the GH3 family involved in the adenylation of IAA or JA with subsequent synthesis of amino acid conjugates ( Staswick and Tiryaki 2004; Staswick and others 2005).”
• Characterization of an Arabidopsis Enzyme Family That Conjugates Amino Acids to Indole-3-Acetic Acidw⃞ (2005, methodology): “11 (JAR1) is a jasmonic acid–amido synthetase that conjugates several amino acids to jasmonic acid (JA) (Staswick and Tiryaki, 2004).”
• Jasmonates: biosynthesis, perception, signal transduction and action in plant stress response, growth and development. An update to the 2007 review in Annals of Botany. (2013, background): “Besides the compounds mentioned above, JA also occurs conjugated to 1-aminocyclopropane-1-carboxylic acid (ACC), the ET precursor (Staswick and Tiryaki, 2004).”