RNA regulation: a new genetics?

By John S. Mattick. Nature reviews genetics, 2004

763 citations recorded by the source corpus.

View Paper: https://www.semanticscholar.org/paper/8a554fc7002e0cc0dbcf3b05870608a72d442bcc

How researchers see this paper

The researchers whose trusted networks rank it highest, strongest advocate first. Every researcher gets a different order.

In Molecular Biology

Citations in the corpus

Long noncoding RNAs: functional surprises from the RNA world. (2009, background): “…debate as to whether this pervasive transcription represents largely useless transcription (transcriptional ‘‘noise’’) (Wang et al. 2004; Struhl 2007; Ebisuya et al. 2008) or if these noncoding RNAs (ncRNAs) have functions that simply have not yet been identified (for review, see Mattick 2004).”
Regulating gene expression through RNA nuclear retention. (2005, methodology): “…purification of phosphorothioate-modified oligodeoxynucleotides (AS109, GTTTGCTCGCTAGTCAAAT; AS113, TCT TGGTGATGTACTGCTC; AS713, CAGTGCCCTGGCCGCGCGAC; AS716, CGCAGACAGAAGCTCCCGCC) were performed using an Applied Biosystems 380B automated DNA synthesizer as described previously (McKay et al., 1999).”
GENCODE: The reference human genome annotation for The ENCODE Project (2012, background): “…array experiments has indicated that evolution of the developmental processes regulating complex organisms can be attributed to the noncoding regions and not only to the protein-coding regions of the genome (Bertone et al. 2004; Mattick 2004; Kapranov et al. 2007; Clark et al. 2011).”
Long non-coding RNAs: a new frontier in the study of human diseases. (2013, background): “Evidence from whole genome and transcriptome sequencing suggests that the complexity of an organism may be regulated by short or long noncoding RNAs (lncRNAs) which belong to the noncoding portions of the genome [4].”
Molecular mechanisms of long noncoding RNAs (2011, background): “…demonstrating the importance of ncRNAs in the regulation of multiple major biological processes impacting development, differentiation, and metabolism have brought these heretofore neglected molecular players to the forefront (Mercer et al., 2009; Ponting et al., 2009; Wilusz et al., 2009).”
RNA design rules from a massive open laboratory (2014, neutral): “Proc Natl Acad Sci USA 108(2):745–750.”
Non-coding RNAs in disease: from mechanisms to therapeutics (2023, neutral): “Readers are referred to other review articles for insights into additional classes of ncRNAs and their potential role in diseases 19–22 .”