Identification of conserved regions in the plastid genome: implications for DNA barcoding and biological function

By Gernot G. Presting. 2006

82 citations recorded by the source corpus.

View Paper: https://www.semanticscholar.org/paper/83115b58d55ecb6df10ddbd45e198a3c7cb8d2ae

How researchers see this paper

The researchers whose trusted networks rank it highest, strongest advocate first. Every researcher gets a different order.

In Ecology

In Molecular Biology

Citations in the corpus

DNA barcoding in the red algal order Gelidiales: comparison of COI with rbc La nd verification of the "barcoding gap" (2010, background): “The mitochondria-encoded COI locus has been used extensively in animals as a barcoding sequence, but whether this locus is also appropriate for barcoding in vascular plants and algae has been debated (e.g. Presting, 2006; Kress & Erickson, 2007).”
Choosing and Using a Plant DNA Barcode (2011, unknown): “[105].”
An evaluation of rbcL, tufA, UPA, LSU and ITS as DNA barcode markers for the marine green macroalgae (2010, background): “Previous to this study, the only marine green macroalgal genera for which the UPA had been tested were Codium, Prasiola, Rosenvingiella, and Ulva (Sherwood & Presting, 2007).”
UNIVERSAL PRIMERS AMPLIFY A 23S rDNA PLASTID MARKER IN EUKARYOTIC ALGAE AND CYANOBACTERIA 1 (2007, background): “Universal eukaryotic plastid primers were recently designed following analysis of 37 plastid genomes from a variety of algal lineages and land plants (Presting 2006).”
A comparison of two DNA barcode markers for species discrimination in the red algal family Kallymeniaceae (Gigartinales, Florideophyceae), with a description of Euthora timburtonii sp. nov. (2010, background): “Two molecular markers have been proposed as standard markers for species identification in macroalgae: COI-5P, the 5’ region of the mitochondrial cytochrome c oxidase I gene (Saunders 2005, 2008); and UPA, the universal plastid amplicon, domain V of the 23S rRNA gene (Presting 2006).”
Semi-automated, Membrane-Based Protocol for DNA Isolation from Plants (2008, methodology): “Primers for the universal plastid region (Presting 2006) p23SrV_F1 5′ GGACAGAAAGACCCTATGAAGCTT 3′ and p23Srv_R1c 5′ TCAGCCTGTTATCCCTAGAGTAAC 3′ were used as an additional marker to evaluate DNA extractions from Equisetum.”
Multiple Multilocus DNA Barcodes from the Plastid Genome Discriminate Plant Species Equally Well (2008, background): “Other regions, such as a portion of the plastid 23S rDNA locus (referred to as the ‘‘universal plastid amplicon’’ or UPA [13]), and the plastid trnL– trnF intergenic spacer [14] have been proposed.”