Autophagy mediates the mitotic senescence transition.

By A. Young, M. Narita, Manuela Ferreira, K. Kirschner, Mahito Sadaie, Jeremy Darot, S. Tavaré, Satoko Arakawa, S. Shimizu, F. Watt and 1 more. Genes & Development, 2009

1,048 citations recorded by the source corpus.

As a stress response, senescence is a dynamic process involving multiple effector mechanisms whose combination determines the phenotypic quality. Here we identify autophagy as a new effector mechanism of senescence. Autophagy is activated during senescence and its activation is correlated with negative feedback in the PI3K-mammalian target of rapamycin (mTOR) pathway. A subset of autophagy-related genes are up-regulated during senescence: Overexpression of one of those genes, ULK3, induces autophagy and senescence. Furthermore, inhibition of autophagy delays the senescence phenotype, including senescence-associated secretion. Our data suggest that autophagy, and its consequent protein turnover, mediate the acquisition of the senescence phenotype.

Subfields: Epidemiology, Parasitology, Physiology

View Paper: https://www.semanticscholar.org/paper/72181666cfb9ca76463f85e99e8d8beeb19a281b

How researchers see this paper

The researchers whose trusted networks rank it highest, strongest advocate first. Every researcher gets a different order.

In Epidemiology

In Parasitology

In Physiology

Citations in the corpus

Autophagy mediates degradation of nuclear lamina (2015, neutral): “…polybrene, and mixed with trypsinized recipient cells. pLNCX-ER:HRasV12, WZL-hygro, WZL-HRasV12-hygro viral constructs were described elsewhere. sh-Atg7 hairpin sequence GGAGTCACAGCTCTTCCTTAC was from Young et al 22 , and cloned into Tet-pLKO-puro “all-in-one” tetracycline-inducible vector 32 .”
Guidelines for the use and interpretation of assays for monitoring autophagy (3rd edition) (2012, neutral): “Along these lines, ectopic ULK3 displays a punctate pattern upon starvation-induced autophagy induction.(454) ULK3, ULK4 and STK36, however, lack the domains present on ULK1 and ULK2 that bind ATG13 and RB1CC1/FIP200.”
Autophagy and aging. (2011, background): “According to yet-to-be confirmed reports, autophagy is upregulated during and partially required for oncogene-(H-rasV12)-induced senescence (Young et al., 2009) and apoptosis (Elgendy et al.”
The DNA damage response induces inflammation and senescence by inhibiting autophagy of GATA4 (2015, background): “Autophagy is reported to be required for the establishment of senescence (31, 32, 44) or to inhibit senescence (33).”
Autophagy: Renovation of Cells and Tissues (2011, background): “However, the involvement of Ras is not simple; Ras-induced autophagy contributes to tumor suppression by inducing autophagic cell death and senescence (Elgendy et al., 2011; Young et al., 2009).”
Tumor suppressive functions of p53. (2009, background): “Supporting an antioncogenic function, Beclin 1, a conserved protein that is essential for autophagy, is also a haploinsufficient tumor suppressor (Liang et al. 1999; Yue et al. 2003).”