Telomerase maintains telomere structure in normal human cells.

By K. Masutomi, E. Yu, S. Khurts, I. Ben-Porath, Jennifer L. Currier, Geoffrey B. Metz, M. Brooks, S. Kaneko, S. Murakami, J. Decaprio and 3 more. Cell, 2003

765 citations recorded by the source corpus.

Subfields: Aging, Physiology

View Paper: https://www.semanticscholar.org/paper/6544f738b4d2809639d779aa6ed02132a6125841

How researchers see this paper

The researchers whose trusted networks rank it highest, strongest advocate first. Every researcher gets a different order.

In Aging

1. W. Mooi
2. D. Peeper
3. C. Michaloglou
4. T. Kuilman

In Physiology

1. W. Mooi
2. D. Peeper
3. C. Michaloglou
4. T. Kuilman
5. J. Campisi
6. Jesús Gil
7. J. Kirkland

Citations in the corpus

• Synthetic Lethality of Combined Bcl-2 Inhibition and p53 Activation in AML: Mechanisms and Superior Antileukemic Efficacy (2017, methodology): “…et al., 2006 A gift from David Root Addgene Plasmid #10879 pMKO.1 puro p53 shRNA 2: gactccagtggtaatctacttcaagagagta gattacactggagtcttttt Masutomi et al., 2003 A gift from William Hahn Addgene Plasmid #10672 shRNA targeting human MCL1: ccggtgtgaattcatgggctcatcttcaagagaga…”
• The essence of senescence. (2010, background): “They include the loss of proliferation, morphological changes, increased SAb-GAL activity, the production of SAHF, and a rise in 2468 GENES & DEVELOPMENT the levels of DDR markers as well as the cell cycle inhibitors p16INK4A, p15INK4B, p21CIP1, and p53.”