PIWI-interacting small RNAs: the vanguard of genome defence

By M. Siomi, Kaoru Sato, Dubravka Pezic, Alexei Aravin. Nature reviews. Molecular cell biology, 2011

1,305 citations recorded by the source corpus.

Subfields: Molecular Biology, Plant Science

View Paper: https://www.semanticscholar.org/paper/5ee62c75dd23b18554b6a2054f9cd9900c8c4e96

How researchers see this paper

The researchers whose trusted networks rank it highest, strongest advocate first. Every researcher gets a different order.

In Molecular Biology

1. M. Davison
2. Devaki Bhaya
3. Thomas Tuschl
4. Rodolphe Barrangou
5. Iain M. Dykes
6. Jeannie T. Lee
7. M. Hafner
8. S. Gerstberger

In Plant Science

1. Thomas Tuschl
2. Rodolphe Barrangou
3. Jeannie T. Lee
4. Phillip A. Sharp

Citations in the corpus

• Long Noncoding RNAs: Past, Present, and Future (2013, background): “We refer readers to the many excellent recent reviews on these topics (Peculis 2000; Xiao et al. 2002; Henras et al. 2004; Okamura and Lai 2008; Kim et al. 2009; Feuerhahn et al. 2010; Blackburn and Collins 2011; Czech and Hannon 2011; Siomi et al. 2011).”
• A census of human RNA-binding proteins (2014, background): “The piRNA-PIWI complexes (piRNPs) silence transposable elements (TEs) either by endonucleolytic cleavage in the cytoplasm or through transcriptional silencing at their genomic loci in the nucleus (Siomi et al., 2011).”
• Transcriptional and Post-transcriptional Gene Regulation by Long Non-coding RNA (2017, background): “Short ncRNAs include the relatively wellknown microRNAs (miRNAs) [9,10], as well as smallinterfering RNAs (siRNAs) and P-element-induced wimpy testis (PIWI)-interacting RNA (piRNAs) [11], which generally act to negatively regulate gene expression.”
• CRISPR-Cas systems in bacteria and archaea: versatile small RNAs for adaptive defense and regulation. (2011, background): “Overall, although CRISPR is arguably most similar to PIWI-interacting RNAs (piRNAs), which protect genome integrity from parasites such as transposons (103), further studies that examine the molecular basis for CRISPR-based interference will likely expand the list of mechanistic idiosyncrasies and n”
• Transcriptional Silencing of Transposons by Piwi and Maelstrom and Its Impact on Chromatin State and Gene Expression (2012, neutral): “…sequence for mael was CCGAAGCTTGTTCGCTTTCTA y,w,hsFlp122;;act<CD2>GAL4, UAS-GFP (Olivieri et al, 2010) FLAG-eGFP-Mael was cloned by inserting an N-terminal FLAG-eGFP cassette via bacterial recombineering into a genomic rescue construct (3L : 22712955 -22721349) which was integrated into the…”