Sequential cancer mutations in cultured human intestinal stem cells

By J. Drost, R. V. van Jaarsveld, B. Ponsioen, C. Zimberlin, R. van Boxtel, A. Buijs, Norman Sachs, R. Overmeer, G. Offerhaus, H. Begthel and 9 more. Nature, 2015

993 citations recorded by the source corpus.

Subfields: Cancer Research, Molecular Biology, Oncology

View Paper: https://www.semanticscholar.org/paper/4aea55c5cadc4258e5961cf3e33df8b690bf6c0b

How researchers see this paper

The researchers whose trusted networks rank it highest, strongest advocate first. Every researcher gets a different order.

In Cancer Research

1. Hans Clevers

In Molecular Biology

1. Hans Clevers
2. R. Nusse
3. Elaine Fuchs
4. C. Blanpain
5. M. Resh
6. Jessica Rios-Esteves
7. Pengfei Lu

In Oncology

1. Hans Clevers
2. Pengfei Lu

Citations in the corpus

• Modeling Development and Disease with Organoids. (2016, background): “Xenotransplantation revealed the progressive transformation of the wild-type stem cells into adenocarcinomas (Drost et al., 2015; Matano et al., 2015).”
• A Living Biobank of Breast Cancer Organoids Captures Disease Heterogeneity. (2018, neutral): “…gRNA Drost et al., 2015 GACGGAAACCGTAGCTGCC TP53_for Drost et al., 2015 CAGGAAGCCAAAGGGTGAAGA TP53_rev Drost et al., 2015 CCCATCTACAGTCCCCCTTG Recombinant DNA pSpCas9(BB)-2A-GFP Addgene plasmid #…”