Comprehensive molecular portraits of invasive lobular breast cancer

By Giovanni Ciriello, Michael L. Gatza, Andrew H. Beck, Matthew D. Wilkerson, S. Rhie, A. Pastore, Hailei Zhang, M. McLellan, C. Yau, Cyriac Kandoth and 130 more. Cell, 2015

1,708 citations recorded by the source corpus.

Summary Invasive lobular carcinoma (ILC) is the second most prevalent histologic subtype of invasive breast cancer. Here, we comprehensively profiled 817 breast tumors, including 127 ILC, 490 ductal (IDC), and 88 mixed IDC/ILC. Besides E-cadherin loss, the best known ILC genetic hallmark, we identified mutations targeting PTEN, TBX3 and FOXA1 as ILC enriched features. PTEN loss associated with increased AKT phosphorylation, which was highest in ILC among all breast cancer subtypes. Spatially clustered FOXA1 mutations correlated with increased FOXA1 expression and activity. Conversely, GATA3 mutations and high expression characterized Luminal A IDC, suggesting differential modulation of ER activity in ILC and IDC. Proliferation and immune-related signatures determined three ILC transcriptional subtypes associated with survival differences. Mixed IDC/ILC cases were molecularly classified as ILC-like and IDC-like revealing no true hybrid features. This multidimensional molecular atlas sheds new light on the genetic bases of ILC and provides potential clinical options.

Subfields: Cancer Research, Pathology and Forensic Medicine

View Paper: https://www.semanticscholar.org/paper/2d561096a356bd9d9a9540105f66e7c10394829a

How researchers see this paper

The researchers whose trusted networks rank it highest, strongest advocate first. Every researcher gets a different order.

In Cancer Research

In Pathology and Forensic Medicine

Citations in the corpus

Scalable whole-exome sequencing of cell-free DNA reveals high concordance with metastatic tumors (2017, background): “Subclonal cluster 2 (13) Clonal cluster (8) Subclonal cluster 1 (4) Subclonal cluster 2 (4) Tumor-only (25)”
A Living Biobank of Breast Cancer Organoids Captures Disease Heterogeneity. (2018, neutral): “BC heterogeneity is best exemplified by next-generation sequencing studies that have drawn comprehensive molecular BC portraits (Cancer Genome Atlas, 2012; Ciriello et al., 2015) and identified more than 1,600 likely driver mutations in 93 BC genes (Nik-Zainal et al., 2016).”
Genomic Evolution of Breast Cancer Metastasis and Relapse (2017, background): “Large-scale genomics analyses have now been performed in thousands of primary breast cancers, revealing the complex mutational landscape of the disease (Banerji et al., 2012; Cancer Genome Atlas Network, 2012; Ciriello et al., 2015; Ellis et al., 2012; Nik-Zainal et al., 2016; Shah et al., 2012; Ste”
The long tail of oncogenic drivers in prostate cancer (2018, neutral): “2c), similar to other cancer types 21,22 .”
New functionalities in the TCGAbiolinks package for the study and integration of cancer data from GDC and GTEx (2019, methodology): “With both methods we identified upregulated matrix metalloproteinases (such as MMP11 and MMP13) which are a class of enzyme known to be involved in cancer invasion and metastasis and have been linked to breast cancer outcomes [54].”
The somatic mutation profiles of 2,433 breast cancers refines their genomic and transcriptomic landscapes (2016, neutral): “G A T A 3 0 20 40 60 80 100 Medullary (34)”
The Genomic Landscape of Endocrine-Resistant Advanced Breast Cancers (2018, background): “The negative control crRNA (NC#1) was ordered from IDT (Catalog #: 1072544) and the crRNAs targeting NF1 were as follows: sgNF1-1: CGGTTACCTGCTCGTCGAAG, sgNF1-2: CTCGTCGAAGCGGCTGACCA, sgNF1-3: AGTCAGTACTGAGCACAACA and sgNF1-4: GTTGTGCTCAGTACTGACTT.”