Switching and signaling at the telomere.

By Elizabeth H Blackburn. Cell, 2001

2,083 citations recorded by the source corpus.

Subfields: Aging, Physiology

View Paper: https://www.semanticscholar.org/paper/2563274f50439f8a3ef3e96a12bd19064711eb99

How researchers see this paper

The researchers whose trusted networks rank it highest, strongest advocate first. Every researcher gets a different order.

In Aging

1. I. Ben-Porath
2. M. Lei
3. Feng Wang
4. William C. Hahn
5. Yuting Yang
6. R. Weinberg
7. T. Cech
8. E. Podell

In Physiology

1. R. Weinberg
2. I. Ben-Porath
3. M. Lei
4. Feng Wang
5. William C. Hahn
6. Yuting Yang
7. S. Stewart
8. T. Cech

Citations in the corpus

• Telomeres and aging. (2008, neutral): “It has been proposed that telomeres switch between closed and open states (21) as is illustrated in Figures 3 and 4: perhaps the likelihood of the open state is proportional to the overall telomere length of the repeat tract (214).”
• Sequence variants at the TERT- CLPTM1L locus associate with many cancer types (2009, positive): “The major role of telomerase is to catalyse the de novo addition of telomeric repeat sequences onto chromosome ends and thereby counterbalance telomere-dependent replicative aging 19 .”
• Pulmonary Oxidative Stress, Inflammation and Cancer: Respirable Particulate Matter, Fibrous Dusts and Ozone as Major Causes of Lung Carcinogenesis through Reactive Oxygen Species Mechanisms (2013, neutral): “The interplay among telomeric repeats, telomerase and telomere-binding proteins governs a wide range of cellular processes, including chromosomal stability, gene expression and cell replicative life span [133,134].”
• Telomeres and telomerase. (2002, neutral): “Loss of telomere function leads to defects or blocks in chromosome segregation and hence to genomic instability (reviewed in Blackburn 2001).”
• DNA methyltransferases control telomere length and telomere recombination in mammalian cells (2006, neutral): “Primer Chr19end(1) was used in bisulfite sequencing experiments shown in Fig.2b and Fig.4e. Primers Chr19end(2-7) were used in Fig.2d. Bisulfite sequencing Locus 5´primer 3´primer Chr1 end aaaagatggtgagtgtaggtgt tcacaatatcctcctcttcttc Chr16 end gatgggatttggaagggtatt actccctaattaactacaacccatc Chr19 s”
• Epidermal stem cells of the skin. (2006, neutral): “Telomerase is upregulated in many human cancers, and TERT cooperates with other oncogenes to transform normal cells into tumor cells (Blackburn 2001).”
• Telomerase maintains telomere structure in normal human cells. (2003, positive): “In addition to protecting the integrity of chromosomes (Blackburn, 2001), several lines of eviMoreover, we were unable to recover telomerase activity even by IP with the 2C4 mAb in BJ human fibroblasts dence implicate telomere maintenance as a critical regulator of cell lifespan (Wright and Shay, 20”
• Human Telomerase and Its Regulation (2002, neutral): “Due to extensive research efforts in the past few years, we now know that highly conserved telomere structures at the ends of linear chromosomes consist of tandem repeat DNA sequences and associated proteins (21).”