JAZ repressor proteins are targets of the SCFCOI1 complex during jasmonate signalling

By Bryan C. Thines, Leron Katsir, M. Melotto, Yajie Niu, A. Mandaokar, Guanghui Liu, K. Nomura, S. He, G. Howe, J. Browse. Nature, 2007

2,354 citations recorded by the source corpus.

Subfields: Insect Science, Molecular Biology, Plant Science

View Paper: https://www.semanticscholar.org/paper/14a8381c43dec7fb6a92ac4686cb0a89ee100274

How researchers see this paper

The researchers whose trusted networks rank it highest, strongest advocate first. Every researcher gets a different order.

In Insect Science

1. C. Wasternack
2. Martin Heil
3. G. Howe
4. C. Pieterse
5. B. Hause
6. A. Agrawal
7. S. He
8. Susheng Song

In Molecular Biology

1. C. Wasternack
2. Christine H. Foyer
3. S. He
4. Keithanne Mockaitis
5. J. Colcombet
6. Jonathan D. G. Jones
7. Heribert Hirt
8. Belen Marquez-Garcia

In Plant Science

1. C. Wasternack
2. Martin Heil
3. C. Pieterse
4. S. He
5. B. Hause
6. G. Howe
7. A. Agrawal
8. Susheng Song

Citations in the corpus

• Derepression of ethylene-stabilized transcription factors (EIN3/EIL1) mediates jasmonate and ethylene signaling synergy in Arabidopsis (2011, methodology): “Yeast two-hybrid pGADT7 EIN3 (1-300) BamH1 EIN3-1 CGGGATCCTCATGATGTTTAATGAGATG”
• Jasmonate Regulates the INDUCER OF CBF EXPRESSION–C-REPEAT BINDING FACTOR/DRE BINDING FACTOR1 Cascade and Freezing Tolerance in Arabidopsis[W] (2013, background): “Jasmonate is perceived by the F-box protein CORONATINE INSENSITIVE1 (COI1), which subsequently facilitates the degradation of JAZ proteins via the SCFCOI1-26S proteasome pathway (Xu et al., 2002; Chini et al., 2007; Thines et al., 2007; Yan et al., 2009; Sheard et al., 2010).”
• Indirect defence via tritrophic interactions. (2008, background): “The search for its receptor and its mode of action in the regulation of gene expression has only recently seen a significant breakthrough with the discovery of a family of JAZ (jasmonate ZIM-domain) proteins (Chini et al., 2007; Thines et al., 2007).”
• Jasmonates counter plant stress: A Review (2015, background): “insensitive 1 (COI1), it causes degradation of Jasmonate–Zim Domain (JAZ) proteins which are jasmonate transcriptional repressor proteins through 26S proteasome (Chini et al., 2007; Thines et al., 2007).”
• Current trends in the evolutionary ecology of plant defence (2011, background): “2005) or gene identification (Thines et al. 2007; Li et al. 2004), because these provide little insight into the process of jasmonate evolution.”
• Abiotic stress response in plants : when post-transcriptional and post-translational regulations control transcription (2008, background): “Moreover, ubiquitination in the defence response is directly triggered by jasmonic acid, the crucial plant hormone of host immunity [98].”
• Signaling mechanisms in pattern-triggered immunity (PTI). (2015, background): “COI1-mediated degradation of JAZ proteins by enhancing the interaction between COI1 and JAZs, leading to de-repression of JA-related transcriptional activation (Chini et al., 2007; Thines et al., 2007).”
• Plant immunity to insect herbivores. (2008, background): “perception of JA-derived signals such as JA-Ile (124, 129).”
• Jasmonates: biosynthesis, perception, signal transduction and action in plant stress response, growth and development. An update to the 2007 review in Annals of Botany. (2013, background): “3) has been independently developed in three different laboratories (Chini et al., 2007; Thines et al., 2007; Yan et al., 2007) and was subsequently extended by identification of new up-and downstream components .”
• The Jasmonate-ZIM-Domain Proteins Interact with the WD-Repeat/bHLH/MYB Complexes to Regulate Jasmonate-Mediated Anthocyanin Accumulation and Trichome Initiation in Arabidopsis thaliana[C][W] (2011, methodology): “…of the SCFCOI1 complex, contain 12 members and function as negative regulators to repress diverse JA responses, probably by directly inhibiting various transcriptional regulators (Chini et al., 2007; Thines et al., 2007; Yan et al., 2007; Fonseca et al., 2009a; Seo et al., 2011; Song et al., 2011).”
• The Arabidopsis CORONATINE INSENSITIVE1 Protein Is a Jasmonate Receptor[C][W] (2009, methodology): “The procedure for protein pull-down experiments was as described previously (Thines et al., 2007).”
• (+)-7-iso-Jasmonoyl-L-isoleucine is the endogenous bioactive jasmonate. (2009, background): “, JA–amino acid conjugation by JAR1 (Jasmonate-Resistant 1) is necessary for JA activation, and (−)-JA- L -isoleucine ( 6 ) was recently demonstrated to be the molecularly active form of the hormon”