The Arabidopsis CORONATINE INSENSITIVE1 Protein Is a Jasmonate Receptor[C][W]

By Jianbin Yan, Chi Zhang, Min Gu, Zhiyan Bai, Weiguo Zhang, Tiancong Qi, Zhiwei Cheng, W. Peng, Haibin Luo, F. Nan and 2 more. The Plant Cell Online, 2009

740 citations recorded by the source corpus.

Subfields: Insect Science, Molecular Biology, Plant Science

View Paper: https://www.semanticscholar.org/paper/1aac947600897e771adee7109ab6dbeea5077d50

How researchers see this paper

The researchers whose trusted networks rank it highest, strongest advocate first. Every researcher gets a different order.

In Insect Science

1. C. Wasternack
2. Susheng Song
3. B. Hause
4. Jianqiang Wu
5. Fang Wang
6. L. Pauwels
7. M. Kolomiets
8. Ian T. Baldwin

In Molecular Biology

1. Ian T. Baldwin
2. C. Wasternack
3. Ling-Jian Wang
4. B. Hause
5. Diqiu Yu
6. Ying-Bo Mao
7. Xiao-Ya Chen

In Plant Science

1. C. Wasternack
2. Susheng Song
3. B. Hause
4. Fang Wang
5. L. Pauwels
6. M. Kolomiets
7. Ian T. Baldwin
8. Liqun Jiang

Citations in the corpus

• Arabidopsis MYC2 Interacts with DELLA Proteins in Regulating Sesquiterpene Synthase Gene Expression[W][OA] (2012, background): “CORONATINE INSENSITIVE1 (COI1), an F-box protein, is a key component of the receptor complex (Xie et al., 1998; Xu et al., 2002; Yan et al., 2009).”
• Plant Defense Signaling and Responses Against Necrotrophic Fungal Pathogens (2016, neutral): “Activated SCF COI1 promotes the physical interaction between COI1 and JAZ repressors, resulting in the degradation of JAZ repressors by the ubiquitin mediated pathway (Chini and others 2007; Thines and others 2007; Katsir and others 2008; Yan and others 2009 ), thereby releasing bHLH TFs (Fig.”
• The Jasmonate-ZIM-Domain Proteins Interact with the WD-Repeat/bHLH/MYB Complexes to Regulate Jasmonate-Mediated Anthocyanin Accumulation and Trichome Initiation in Arabidopsis thaliana[C][W] (2011, methodology): “Upon perception of a JA signal, COI1 recruits JAZ proteins for ubiquitination and subsequent degradation through the 26S proteasome to activate downstream signal cascades that modulate JA-mediated plant responses (Chini et al., 2007; Thines et al., 2007; Fonseca et al., 2009b; Yan et al., 2009; Shea”
• New insights into plant responses to the attack from insect herbivores. (2010, background): “Recently, the identification of JASMONATE ZIM-DOMAIN ( JAZ) proteins as the repressors of JA-induced responses and COI1 as the receptor of JA-Ile has greatly advanced our understanding of JA signaling (14, 130, 144).”
• Jasmonates: biosynthesis, metabolism, and signaling by proteins activating and repressing transcription (2016, background): “, 2008), and by properties of JA-Ile as the ligand of the complex (Yan et al., 2009; Sheard et al., 2010).”
• Jasmonates counter plant stress: A Review (2015, neutral): “in SCF complex (Yan et al., 2009; Sheard et al., 2010).”
• Derepression of ethylene-stabilized transcription factors (EIN3/EIL1) mediates jasmonate and ethylene signaling synergy in Arabidopsis (2011, neutral): “Yeast two-hybrid pGADT7 EIN3 (1-300) BamH1 EIN3-1 CGGGATCCTCATGATGTTTAATGAGATG”
• Jasmonates: biosynthesis, perception, signal transduction and action in plant stress response, growth and development. An update to the 2007 review in Annals of Botany. (2013, background): “Photoaffinity-based cross-linking of JA-Ile to COI1 substantiated this idea (Yan et al., 2009).”
• The JAZ Proteins: A Crucial Interface in the Jasmonate Signaling Cascade (2011, background): “Direct interaction with COI1 has been shown for at least JAZ1 (At1g19180), JAZ2 (At1g74950), JAZ3 (At3g17860), JAZ6 (At1g72450), JAZ9 (At1g70700), and JAZ10 (At5g13220) (Table 1) (Thines et al., 2007; Melotto et al., 2008; Chini et al., 2009b; Chung and Howe, 2009; Yan et al., 2009; Sheard et al., 2”
• Jasmonate Biosynthesis, Perception and Function in Plant Development and Stress Responses (2013, background): “The only jasmonate receptor identified to date has been the COI1 protein (Katsir et al., 2008; Yan et al., 2009), but interestingly, only JA-Ile was found as a ligand of the SCFCOI1 E3 ubiquitin ligase complex (Thines et al.”
• Jasmonate Regulates the INDUCER OF CBF EXPRESSION–C-REPEAT BINDING FACTOR/DRE BINDING FACTOR1 Cascade and Freezing Tolerance in Arabidopsis[W] (2013, background): “Previous studies have shown that disruption of the jasmonate receptor COI1 protein permits JAZ repressors to accumulate in the nucleus (Chini et al., 2007; Thines et al., 2007), thereby repressing downstream transcription factors.”