A Method for Studying Protistan Diversity Using Massively Parallel Sequencing of V9 Hypervariable Regions of Small-Subunit Ribosomal RNA Genes

By L. Amaral-Zettler, Elizabeth A. McCliment, H. Ducklow, Susan M. Huse. PLoS ONE, 2009

976 citations recorded by the source corpus.

Background Massively parallel pyrosequencing of amplicons from the V6 hypervariable regions of small-subunit (SSU) ribosomal RNA (rRNA) genes is commonly used to assess diversity and richness in bacterial and archaeal populations. Recent advances in pyrosequencing technology provide read lengths of up to 240 nucleotides. Amplicon pyrosequencing can now be applied to longer variable regions of the SSU rRNA gene including the V9 region in eukaryotes. Methodology/Principal Findings We present a protocol for the amplicon pyrosequencing of V9 regions for eukaryotic environmental samples for biodiversity inventories and species richness estimation. The International Census of Marine Microbes (ICoMM) and the Microbial Inventory Research Across Diverse Aquatic Long Term Ecological Research Sites (MIRADA-LTERs) projects are already employing this protocol for tag sequencing of eukaryotic samples in a wide diversity of both marine and freshwater environments. Conclusions/Significance Massively parallel pyrosequencing of eukaryotic V9 hypervariable regions of SSU rRNA genes provides a means of estimating species richness from deeply-sampled populations and for discovering novel species from the environment.

Subfields: Ecology, Molecular Biology

View Paper: https://www.semanticscholar.org/paper/11edf8cfb147366cb36b9054b0c7cd524e031662

How researchers see this paper

The researchers whose trusted networks rank it highest, strongest advocate first. Every researcher gets a different order.

In Ecology

In Molecular Biology

Citations in the corpus

Methods for the extraction, storage, amplification and sequencing of DNA from environmental samples (2018, background): “2013), the V5-V7 region (Meadow & Zabinski 2012), and most commonly, the V9 region (Amaral-Zettler et al. 2009; Ramirez et al. 2014).”
Multiple marker parallel tag environmental DNA sequencing reveals a highly complex eukaryotic community in marine anoxic water (2010, background): “However, the highly conserved nature of this 1391F primer appears to recover more higher-taxon groups compared to an alternative primer targeting the same gene region but designed for eukaryotes only (Amaral-Zettler et al. 2009).”
Eukaryotic plankton diversity in the sunlit ocean (2015, methodology): “We used universal eukaryotic primers (68) to PCR-amplify (25 cycles in triplicate) the V9-18S rDNA genes from all Tara Oceans samples.”
Structure and Function of the Bacterial Root Microbiota in Wild and Domesticated Barley (2015, methodology): “Cell Hos plained by the high number and variability of rRNA operon copy number in eukaryotes (Amaral-Zettler et al., 2009).”
Toward a global reference database of COI barcodes for marine zooplankton (2021, methodology): “Metabarcoding using hypervariable regions of the nuclear 18S ribosomal RNA (rRNA) gene has been used for detection of marine microbial diversity (Amaral-Zettler et al. 2009; DeVargas et al. 2015).”
Global biogeography of marine fungi is shaped by the environment (2016, methodology): “Here, we use the dataset containing the eukaryotic environmental samples, processed in a single laboratory, using identical loci and protocols (Amaral-Zettler et al., 2009) and replicated amongst 56 water and sediment samples collected from various research groups from around the world’s oceans.”
Insights into global diatom distribution and diversity in the world’s ocean (2016, methodology): “For eukaryotes, recent reports have proposed the use of partial 18S ribosomal DNA (rDNA) sequences as potential molecular markers (34).”
Life in the "plastisphere": microbial communities on plastic marine debris. (2013, methodology): “Eukaryotic amplicon sequencing targeted the V9 hypervariable region and followed protocols established in Amaral-Zettler et al. (2009).33 Sequence data are deposited in NCBI’s Sequence Read Archive (SRP026054) and conform to the Minimum Information about a MARKer gene Sequence (MIMARKS) standard…”
Evaluation of Filtration and DNA Extraction Methods for Environmental DNA Biodiversity Assessments across Multiple Trophic Levels (2017, methodology): “PCR reactions were run in triplicate 25 µl reactions for each sample using 12-basepair Golay barcoded reverse primers (Amaral-Zettler et al., 2009; Table 1).”
A microbial clock provides an accurate estimate of the postmortem interval in a mouse model system (2013, methodology): “18S primers were based on Amaral-Zettler et al. (2009), Euk1391f (GTACACACCGCCCGTC) and EukBr (TGATCCTTCTGC AGGTTCACCTAC).”
Revisions to the Classification, Nomenclature, and Diversity of Eukaryotes (2018, background): “36 One more genus name – Heteroraphidiophrys, mentioned in Mikrjukov (2002) was never formally introduced and needs to be avoided; the organisms designated by it need to be reisolated, carefully studied and provided with formal description.”
Connected macroalgal‐sediment systems: blue carbon and food webs in the deep coastal ocean (2019, methodology): “…project 18S rRNA gene universal primer pair Euk1391F (GTACACACCGCCCGTC) and EukBr (TGATCCTTCTGCAGGTTCACCTAC) (available online).9 This primer pair is based on those first published by Amaral-Zettler et al. (2009) but has been subsequently modified to minimize amplification of bacteria and archaea.”
Distribution patterns of soil microbial eukaryotes suggests widespread algivory by phagotrophic protists as an alternative pathway for nutrient cycling (2017, methodology): “Prokaryotic SSU sequences were truncated from the general primer 1389F (TTGTACACACCGCCC) (Amaral-Zettler et al., 2009) to the end of the SSU rRNA sequence and kept as ortholog of the eukaryotic V9 fragment.”