OligoArray 2.0: design of oligonucleotide probes for DNA microarrays using a thermodynamic approach.

By J. Rouillard, M. Zuker, E. Gulari. Nucleic Acids Research, 2003

417 citations recorded by the source corpus.

Subfields: Molecular Biology

View Paper: https://www.semanticscholar.org/paper/111d21d36fe225e2759526d2854fdb97ade13dd7

How researchers see this paper

The researchers whose trusted networks rank it highest, strongest advocate first. Every researcher gets a different order.

In Molecular Biology

1. Jian Ma
2. Olgica Milenkovic
3. Yongbo Yuan
4. Huimin Zhao
5. E. Genersch
6. L. Gauthier
7. G. Budge
8. S. M. Hossein

Citations in the corpus

• Standard methods for molecular research in Apis mellifera (2013, background): “…is maximized with a range of nano-technological innovations (Yuen et al., 2003; Noerholm et al., 2004; Fiorini and Chiu, 2005), improved 24 Evans et al. oligonucleotide design (Rouillard et al., 2003) and with replication of the spots or even whole arrays (an array of arrays) across the slide.”
• A Rewritable, Random-Access DNA-Based Storage System (2015, background): “For example, for the address a = AGTAAGTCTCGCAGTCATCG, if the prefix a(16) = AGTAAGTCTCGCAGTC appears as a subword, say V, in X = Encodea,l(x) then X is modified to X′ by mapping V to V′ = AGTAATCGGTCCAGTC.”