Improved vectors and genome-wide libraries for CRISPR screening

By Neville E. Sanjana, Ophir Shalem, Feng Zhang. Nature Methods, 2014

4,874 citations recorded by the source corpus.

Genome-wide, targeted loss-of-function pooled screens using the CRISPR (clustered regularly interspaced short palindrome repeats)–associated nuclease Cas9 in human and mouse cells provide an alternative screening system to RNA interference (RNAi) and have been used to reveal new mechanisms in diverse biological models1–4. Previously, we used a Genome-scale CRISPR Knock-Out (GeCKO) library to identify loss-of-function mutations conferring vemurafenib resistance in a melanoma model1. However, initial lentiviral delivery systems for CRISPR screening had low viral titer or required a cell line already expressing Cas9, limiting the range of biological systems amenable to screening.

Subfields: Cardiology and Cardiovascular Medicine, Molecular Biology, Plant Science

View Paper: https://www.semanticscholar.org/paper/f385142fc8cf992168620034cd46958c4922fb6c

How researchers see this paper

The researchers whose trusted networks rank it highest, strongest advocate first. Every researcher gets a different order.

In Cardiology and Cardiovascular Medicine

In Molecular Biology

In Plant Science

Citations in the corpus

CRISPR-Cas9 Knockin Mice for Genome Editing and Cancer Modeling (2014, methodology): “SgRNAs targeting Myd88 and A20 were cloned into a lentiviral vector (Sanjana et al., 2014).”
CRISPR technology: A decade of genome editing is only the beginning (2023, background): “The ease of designing and cloning guide RNA (gRNAs) has enabled the development of gRNA libraries up to genome-wide scales, allowing researchers to perturb every gene in the human genome (47, 48).”
SARS-CoV-2 Infection Depends on Cellular Heparan Sulfate and ACE2 (2020, methodology): “TGACCTGCTCCCTCTCAACG-3’) was cloned into the lentiGuide-Puro plasmid (Addgene plasmid #52963) following published procedure (Sanjana et al., 2014).”
CRISPR/Cas9 in Genome Editing and Beyond. (2016, methodology): “Alternatively, it is possible to use vectors that encode both Cas9 and a single sgRNA (139, 141).”
FerrDb V2: update of the manually curated database of ferroptosis regulators and ferroptosis-disease associations (2022, methodology): “CRISPR gRNAs from the human CRISPR knockout pooled library GeCKO v2 was a gift from Feng Zhang (Addgene #1000000048, #1000000049) (39).”
Repurposing the CRISPR-Cas9 system for targeted DNA methylation (2016, methodology): “Sequences of the non-targeting (NT) control guide RNAs, without a target in the human genome, were taken from the Human GeCKOv2 Library (36).”
Genome-wide CRISPR screen in a mouse model of tumor growth and metastasis (2015, methodology): “We utilized a pooled genome-wide mouse sgRNA library (termed mouse genome-scale CRISPR knockout library A, or mGeCKOa) containing 67,405 sgRNAs targeting 20,611 protein-coding genes and 1,175 microRNA precursors in the mouse genome (Sanjana et al., 2014).”
Targeting FTO suppresses cancer stem cell maintenance and immune evasion (2020, positive): “CRISPR-Cas9-based Knockout of LILRB4 in MONOMAC 6 AML Cells: The MONOMAC 6 cells were infected with Cas9-expressing lentivirus (lentiCas9-Blast) (Sanjana et al., 2014) and single clones were selected with 10 μg/ml blasticidin (ant-bl-1, Su et al.”
Mutations in EXTL3 Cause Neuro-immuno-skeletal Dysplasia Syndrome. (2017, methodology): “Three different single guide RNAs (sgRNAs)—5’-CTTCTCTATAACGTCA GTAC-3’, 5’-GGGACTGGCTTTCGGCCTAT-3’, and 5’-AGAAGCT CGGGACCGCATCG-3’—were each inserted into a pLentiCRISPR v.2 vector (52961, Addgene) as described by Sanjana et al.39 The pLentiCRISP v.2 construct containing the EXTL3 sgRNA or the empt”
LINE-1 derepression in senescent cells triggers interferon and inflammaging (2019, positive): “0 resource (Feng Zhang Lab, MIT, http://genome-engineering.org/gecko/?page_id=15) 59 , were tested and the following ones were chosen: IFNAR1 (HGLibA_29983) AACAGGAGCGATGAGTCTGTA; IFNAR2 (HGLibA_29985) GTGTATATCAGCCTCGTGTT.”
YY1 Is a Structural Regulator of Enhancer-Promoter Loops (2017, positive): “Two additional lentiviral constructs were generated (pAW12.lentiguide-GFP, pAW13.lentiguide-mCherry) by modifying lentiGuide-puro (lentiGuide-Puro was a gift from Feng Zhang (Addgene plasmid # 52963) (Sanjana et al., 2014)) to remove the puromycin and replace it either GFP or mCherry.”
Whole organism lineage tracing by combinatorial and cumulative genome editing (2016, methodology): “126 To determine whether the means of editing reagent delivery influences patterns of barcode 127 editing, we introduced a lentiviral vector expressing Cas9 and the same sgRNA to cells 128 containing the v5 barcode (24).”
Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9 (2016, positive): “The distribution of Rule Set 1 scores for the previously-published GeCKO 6,15 and Koike-Yusa et al. 8 libraries resembles the null distribution, as these were not designed with on-target criteria ( Fig.”