Novel universal primers establish identity of an enormous number of animal species for forensic application

By S. Verma, L. Singh. 2002

278 citations recorded by the source corpus.

How researchers see this paper

The researchers whose trusted networks rank it highest, strongest advocate first. Every researcher gets a different order.

A high incidence of species substitution and mislabelling detected in meat products sold in South Africa (2013, methodology): “450 bp fragment of themtDNA cytochrome b (cyt b) gene following the method described by Verma and Singh (2003). PCR amplification success was confirmed by gel electrophoresis and PCR products were purified with the NucleoFast 96 PCR Clean-”
Wildlife DNA forensics—bridging the gap between conservation genetics and law enforcement (2009, background): “A particular advantage associated with sequencing is that universal PCR primers can be employed enabling the amplification of DNA from a wide range of species without any prior information regarding the sample (Verma & Singh 2003).”
An In silico approach for the evaluation of DNA barcodes (2010, unknown): “MCB mcb398 TACCATGAGGACAAATATCATTCTG 472 All Vertebrates [30]”