BamTools: a C++ API and toolkit for analyzing and managing BAM files
By Derek W. Barnett, Erik K. Garrison, Aaron R. Quinlan, Michael P. Strömberg, Gabor T. Marth. Bioinform., 2011
969 citations recorded by the source corpus.
MOTIVATION Analysis of genomic sequencing data requires efficient, easy-to-use access to alignment results and flexible data management tools (e.g. filtering, merging, sorting, etc.). However, the enormous amount of data produced by current sequencing technologies is typically stored in compressed, binary formats that are not easily handled by the text-based parsers commonly used in bioinformatics research. RESULTS We introduce a software suite for programmers and end users that facilitates research analysis and data management using BAM files. BamTools provides both the first C++ API publicly available for BAM file support as well as a command-line toolkit. AVAILABILITY BamTools was written in C++, and is supported on Linux, Mac OSX and MS Windows. Source code and documentation are freely available at http://github.org/pezmaster31/bamtools.
Subfields: Information Systems and Management, Molecular Biology
View Paper: https://www.semanticscholar.org/paper/d971173f9debd66e2b5e099739f72fd9cdc7dae1
How researchers see this paper
The researchers whose trusted networks rank it highest, strongest advocate first. Every researcher gets a different order.
In Molecular Biology
- Peter D. Stenson
- David N. Cooper
- Eric C. Wooten
- Steven Kelly
- Hajime Uno
- Rob Patro
- Rachel Karchin
- Christopher Douville
Citations in the corpus
- β-Glucan Reverses the Epigenetic State of LPS-Induced Immunological Tolerance (2016, neutral): “…3′R 5′ TGTGCAGCTCCAGAGTCACC 3′ This paper N/A Software and Algorithms Bedtools (Quinlan and Hall, 2010) http://bedtools.readthedocs.io/en/latest/ Bamtools (Barnett et al., 2011) https://github.com/pezmaster31/bamtools Samtools (Li and Durbin, 2009) http://samtools.sourceforge.net/ GSNAP…”
- TransRate: reference-free quality assessment of de novo transcriptome assemblies (2015, methodology): “Implementation TransRate is written in Ruby and C++, and makes use of the BioRuby (Goto et al., 2010) and Bamtools (Barnett et al., 2011) libraries.”
- Tumor aneuploidy correlates with markers of immune evasion and with reduced response to immunotherapy (2017, methodology): “The resulting filtered output files were then analyzed using BamTools to ascertain insert sizes and the total number of uniquely mapped reads present in each sample (69).”
- Metabolic Induction of Trained Immunity through the Mevalonate Pathway. (2018, neutral): “…King et al., 2015 Bwa Li and Durbin 2009 http://bio-bwa.sourceforge.net/ Samtools and Bamtools Barnett et al., 2011, Li et al., 2009 https://code.google.com/archive/p/ phantompeakqualtools/ http://samtools.sourceforge.net/…”
- BCG Vaccination Protects against Experimental Viral Infection in Humans through the Induction of Cytokines Associated with Trained Immunity. (2018, neutral): “2 Beckman Coulter GraphPad Prism Graphpad Software https://www.graphpad.com MMSEQ Turro et al., 2011 https://github.com/eturro/mmseq DEseq Anders and Huber, 2010 http://bioconductor.org/packages/release/ bioc/html/DESeq.html Bwa Li and Durbin, 2009 http://bio-bwa.sourceforge.net/ Samtools and Bamtoo”
- Identifying Mendelian disease genes with the Variant Effect Scoring Tool (2013, methodology): “Unmapped reads and duplicates were then removed using the Bamtools [47] and picard software http://picard.source-forge.net.”