Mecoptera is paraphyletic: multiple genes and phylogeny of Mecoptera and Siphonaptera

By Michael Whiting. 2002

544 citations recorded by the source corpus.

Subfields: Ecology, Evolution, Behavior and Systematics, Genetics

View Paper: https://www.semanticscholar.org/paper/d3537d8be461ca0419bc02920d0f4d69b50c0214

How researchers see this paper

The researchers whose trusted networks rank it highest, strongest advocate first. Every researcher gets a different order.

In Ecology, Evolution, Behavior and Systematics

1. S. Cameron
2. K. Klass
3. Gavin J. Svenson
4. J. Cryan
5. Michael Whiting
6. K. Miller
7. M. Picker
8. J. Damgaard

In Genetics

1. S. Cameron
2. J. Cryan
3. Gavin J. Svenson
4. Michael Whiting
5. K. Miller
6. K. Jarvis
7. F. Haas
8. H. Letsch

Citations in the corpus

• The evolution of food preferences in Coccinellidae (2009, methodology): “0 + 9R (Whiting, 2002; Jarvis et al., 2004).”
• Gondwanan radiation of the Southern Hemisphere crayfishes (Decapoda: Parastacidae): evidence from fossils and molecules (2010, background): “…for two mitochondrial genes, 16S rRNA (Crandall & Fitzpatrick, 1996) and cytochrome c oxidase subunit I (COI; Folmer et al., 1994), and two nuclear genes, 18S rRNA (Whiting et al., 1997; Whiting, 2002) and 28S rRNA (Whiting et al., 1997; Whiting, 2002), for each sample using published primer sets.”
• Phylogeny of earwigs (Insecta: Dermaptera) based on molecular and morphological evidence: reconsidering the classification of Dermaptera (2005, methodology): “The primers used, in addition to those in Whiting (2002) .”
• Phylogenetic species delimitation of the earthworms Eisenia fetida (Savigny, 1826) and Eisenia andrei Bouché, 1972 (Oligochaeta, Lumbricidae) based on mitochondrial and nuclear DNA sequences (2005, background): “According to Wiens and Penkrot’s (2002) protocol, failure of haplotypes from the same locality to cluster together is potential evidence for gene flow between localities (i.”
• A mitochondrial genome phylogeny of the Neuropterida (lace‐wings, alderflies and snakeflies) and their relationship to the other holometabolous insect orders (2009, methodology): “Eleven orders are traditionally recognized within Holometabola, and there is strong evidence from both morphological and molecular data sets for the monophyly of nine of these (Whiting 2002a).”
• The Decapod Tree of Life: Compiling the Data and Moving toward a Consensus of Decapod Evolution (2009, methodology): “The 16S large ribosomal subunit (~ 550 bps, CRANDALL & FITZPATRICK 1996) was selected as the mitochondrial gene, and the 18S small ribosomal subunit (~ 1900 bps, WHITING et al. 1997; WHITING 2002), 28S large ribosomal subunit (~ 2500 bps, WHITING et al.”
• Phylogeny and evolution of Staphyliniformia and Scarabaeiformia: forest litter as a stepping stone for diversification of nonphytophagous beetles (2015, methodology): “The first approximately 1300 bp comprising the 5′ end of this amplification product was sequenced with the primers ZX1 and rd5b (antisense; CCACAGCGCCAGTTCTGCTTAC; Whiting, 2002).”
• A molecular phylogeny of fleas (Insecta: Siphonaptera): origins and host associations (2008, background): “More recently, a sister group relationship between the mecopteran family Boreidae and fleas was pinpointed via molecular data from four genetic markers (Whiting, 2002), and is bolstered by morphological evidence.”
• Phylogeny of the holometabolous insect orders: molecular evidence (2002, background): “1997), with the exception of Mecoptera which appears to be paraphyletic with respect to Siphonaptera (see Whiting 2002).”
• Decapod phylogenetics and molecular evolution (2009, background): “18S rRNA 18s 1f TAC CTG GTT GAT CCT GCC AGT AG * Whiting et al. 1997, Whiting 2002 18s b3.0 GAC GGT CCA ACA ATT TCA CC * Whiting et al. 1997, Whiting 2002 18s a0.79 TTA GAG TGC TYA AAG C * Whiting et al. 1997, Whiting 2002 18s bi GAG TCT CGT TCG TTA TCG GA * Whiting et al. 1997, Whiting 2002 18s a2.”
• A molecular phylogeny of Hexapoda (2006, background): “The most infl uential and pro - duc tive group of workers on insect molecular phylogenetics (WHITING et al. 1997, 2003; WHEELER et al. 2001; WHITING 2002a,b; SVENSON & WHITING 2004; TERRY & WHITING 2005a,b) favor unadjusted computer alignments, and most recently, a direct optimization approach…”
• The biology of blood-sucking in insects (2005, unknown): “Similar insects may well have been the ancestors of the fleas, a view receiving support from molecular systematics (Whiting, 2002).”
• Molecular phylogeny of Cicadomorpha (Insecta: Hemiptera: Cicadoidea, Cercopoidea and Membracoidea): adding evidence to the controversy (2005, methodology): “…across divergent domains continuously; (2) manual alignment of sequences, blocking divergent domains across monophyletic superfamilies (as in Whiting, 2002b); (3) aligning divergent domains using CLUSTAL X under five ‘gap opening : gap extension’ cost ratios (specifically 1 : 1, 50 : 1, 50…”
• Phylogeny of cockroaches (Insecta, Dictyoptera, Blattodea), with placement of aberrant taxa and exploration of out‐group sampling (2012, result): “This result is consistent with Svenson & Whiting’s (2009) molecular analyses, but differs from the morphology-based results of Klass (1995, 1997) and Klass & Meier (2006), as well as from the results of Yager & Svenson’s (2008) molecular analyses. Svenson & Whiting (2009) is a better reference for a”
• FOSSIL CALIBRATIONS FOR THE ARTHROPOD TREE OF LIFE (2016, background): “Paraphyly of the traditional concept of Mecoptera (i.e. inclusion of Siphonaptera) was proposed by Whiting (2002) on the basis of four nuclear genes.”
• The impact of rRNA secondary structure consideration in alignment and tree reconstruction: simulated data and a case study on the phylogeny of hexapods. (2010, result): “The latter hypothesis is congruent to recent views onmecopteroid relationships (Whiting et al. 1997; Bilinski et al. 1998; Bilinski and Buening 1998; Buening 1998; Whiting 2002b, 2002a; Beutel and Pohl 2006a).”