Telomere maintenance by recombination in human cells
By M. Dunham, A. Neumann, C. Fasching, R. Reddel. Nature Genetics, 2000
914 citations recorded by the source corpus.
Subfields: Biotechnology, Physiology, Pollution
View Paper: https://www.semanticscholar.org/paper/6966e62f7be1d618e54ca5b4c189ebb32125b051
How researchers see this paper
The researchers whose trusted networks rank it highest, strongest advocate first. Every researcher gets a different order.
In Biotechnology
In Physiology
In Pollution
Citations in the corpus
- How shelterin solves the telomere end-protection problem. (2010, background): “This so-called alternative lengthening of telomeres (ALT) pathway is thought to involve BIR-like telomere extension events using either telomeres or extrachromosomal telomeric DNA as a template (Dunham et al. 2000).”
- Telomeres and telomerase. (2002, neutral): “ALT pathway become elongated by a process of homologous recombination between telomeres on different chromosomes [30].”
- Telomeres: Linking stress and survival, ecology and evolution (2010, background): “Some immortalized mammalian cell lines and tumors are able to maintain telomere length through recombination in a process termed ALT (Alternative Lengthening of Telomeres; Dunham et al., 2000; Aubert et al., 2008).”
- Alternative lengthening of telomeres in mammalian cells (2002, background): “…intratelomeric strand invasion and t-loop formation (Gri th et al., 1999) also permits a telomere to elongate by using itself as a copy template, or that copying of DNA from one telomere to another has an intermediate step involving extrachromosomal telomeric DNA sequences (Dunham et al., 2000).”
- Advance Publication by J-STAGE Japanese Journal of Infectious Diseases Isolation of human coronaviruses OC43, HKU1, NL63, and 229E in Yamagata, Japan, using primary human airway epithelium cells cultured by employing an air-liquid interface culture (2020, neutral): “Although the ALT mechanism has not been fully elucidated, it is mainly based on homologous recombination (HR) between telomeres of sister chromatids [52].”
- DNA methyltransferases control telomere length and telomere recombination in mammalian cells (2006, background): “Bisulfite sequencing Locus 5 ́primer 3 ́primer Chr1 end aaaagatggtgagtgtaggtgt tcacaatatcctcctcttcttc Chr16 end gatgggatttggaagggtatt actccctaattaactacaacccatc Chr19 start tagtgttggggtgtatataagtagt ctaaccaaccttaactacttctatc Chr19 end(1) atagaagttaagaaataaatggaggt ctctcacctattcaaactaatttc Chr19 end(2”