The Architecture of SARS-CoV-2 Transcriptome

By Dongwan Kim, Joo-Yeon Lee, Jeong-Sun Yang, J. Kim, V. Narry Kim, Hyeshik Chang. 2020

1,990 citations recorded by the source corpus.

SARS-CoV-2 is a betacoronavirus that is responsible for the COVID-19 pandemic. The genome of SARS-CoV-2 was reported recently, but its transcriptomic architecture is unknown. Utilizing two complementary sequencing techniques, we here present a high-resolution map of the SARS-CoV-2 transcriptome and epitranscriptome. DNA nanoball sequencing shows that the transcriptome is highly complex owing to numerous recombination events, both canonical and noncanonical. In addition to the genomic RNA and subgenomic RNAs common in all coronaviruses, SARS-CoV-2 produces a large number of transcripts encoding unknown ORFs with fusion, deletion, and/or frameshift. Using nanopore direct RNA sequencing, we further find at least 41 RNA modification sites on viral transcripts, with the most frequent motif being AAGAA. Modified RNAs have shorter poly(A) tails than unmodified RNAs, suggesting a link between the internal modification and the 3′ tail. Functional investigation of the unknown ORFs and RNA modifications discovered in this study will open new directions to our understanding of the life cycle and pathogenicity of SARS-CoV-2. Highlights We provide a high-resolution map of SARS-CoV-2 transcriptome and epitranscriptome using nanopore direct RNA sequencing and DNA nanoball sequencing. The transcriptome is highly complex owing to numerous recombination events, both canonical and noncanonical. In addition to the genomic and subgenomic RNAs common in all coronaviruses, SARS-CoV-2 produces transcripts encoding unknown ORFs. We discover at least 41 potential RNA modification sites with an AAGAA motif.

Subfields: Cancer Research, Molecular Biology

How researchers see this paper

The researchers whose trusted networks rank it highest, strongest advocate first. Every researcher gets a different order.

In Cancer Research

Ivan Dikic

In Molecular Biology

Citations in the corpus

Nanopore sequencing technology, bioinformatics and applications (2021, methodology): “In the SARS-CoV-2 pandemic 151 , ONT sequencing was used to reconstruct full-length SARS-CoV-2 genome sequences via cDNA and direct RNA sequencing 152–155 , providing valuable information regarding the biology, evolution and pathogenicity of the virus.”
SARS-CoV-2 Orf6 hijacks Nup98 to block STAT nuclear import and antagonize interferon signaling (2020, result): “Remarkably, and in agreement with previous observations (34), within the already reduced total transcript counts of infected cells, 73% (median) of detected transcripts were from SARS-CoV-2.”
Molecular Architecture of the SARS-CoV-2 Virus (2020, positive): “SARS-CoV-2 encodes at least 29 proteins in its (+) RNA genome, four of which are structural proteins: the spike (S), membrane (M), envelope (E) and nucleocapsid (N) proteins (Kim et al., 2020).”
COVID-19 and the human innate immune system (2021, background): “, 2020), caused by severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) (Kim et al., 2020; Wu et al., 2020; Yao et al., 2020; Zhang and Holmes, 2020) is a rather heterogeneous disease.”
Papain-like protease regulates SARS-CoV-2 viral spread and innate immunity (2020, positive): “SARS-CoV-2 subgenomic RNA4 encoding E gene, which is processed during discontinuous transcription in productively infected cells 73 , was quantified using primer pairs (fwd: AACGTACCTGTCTCTTCCGA; rev: CCAACCAACTTTCGATCTCTTGT) spanning a junction of the SARS-CoV-2 subgenomic RNAs and used as a…”