MiFish, a set of universal PCR primers for metabarcoding environmental DNA from fishes: detection of more than 230 subtropical marine species

By M. Miya, Yukuto Sato, Tsukasa Fukunaga, T. Sado, J. Poulsen, Keiichi Sato, Toshifumi Minamoto, S. Yamamoto, H. Yamanaka, H. Araki and 2 more. Royal Society Open Science, 2015

1,278 citations recorded by the source corpus.

We developed a set of universal PCR primers (MiFish-U/E) for metabarcoding environmental DNA (eDNA) from fishes. Primers were designed using aligned whole mitochondrial genome (mitogenome) sequences from 880 species, supplemented by partial mitogenome sequences from 160 elasmobranchs (sharks and rays). The primers target a hypervariable region of the 12S rRNA gene (163–185 bp), which contains sufficient information to identify fishes to taxonomic family, genus and species except for some closely related congeners. To test versatility of the primers across a diverse range of fishes, we sampled eDNA from four tanks in the Okinawa Churaumi Aquarium with known species compositions, prepared dual-indexed libraries and performed paired-end sequencing of the region using high-throughput next-generation sequencing technologies. Out of the 180 marine fish species contained in the four tanks with reference sequences in a custom database, we detected 168 species (93.3%) distributed across 59 families and 123 genera. These fishes are not only taxonomically diverse, ranging from sharks and rays to higher teleosts, but are also greatly varied in their ecology, including both pelagic and benthic species living in shallow coastal to deep waters. We also sampled natural seawaters around coral reefs near the aquarium and detected 93 fish species using this approach. Of the 93 species, 64 were not detected in the four aquarium tanks, rendering the total number of species detected to 232 (from 70 families and 152 genera). The metabarcoding approach presented here is non-invasive, more efficient, more cost-effective and more sensitive than the traditional survey methods. It has the potential to serve as an alternative (or complementary) tool for biodiversity monitoring that revolutionizes natural resource management and ecological studies of fish communities on larger spatial and temporal scales.

Subfields: Ecology, Molecular Biology

View Paper: https://www.semanticscholar.org/paper/4da7964e54721b05999a4c23d2a8ee1e1356ca35

How researchers see this paper

The researchers whose trusted networks rank it highest, strongest advocate first. Every researcher gets a different order.

In Ecology

In Molecular Biology

Citations in the corpus

A comprehensive and comparative evaluation of primers for metabarcoding eDNA from fish (2020, background): “Since different metabarcoding primers may show divergent taxonomic ranges in amplification, multiple primer sets can be used in combination to increase taxonomic coverage and species detection probability (Evans et al., 2017; Miya et al., 2015; Shaw et al., 2016).”
Reference databases, primer choice, and assay sensitivity for environmental metabarcoding: Lessons learnt from a re‐evaluation of an eDNA fish assessment in the Volga headwaters (2020, background): “Therefore, other mitochondrial markers, particularly fragments of the mitochondrial 12S and 16S rRNA genes, have been the focus for metabarcoding primer design for this group (Evans et al., 2016; Miya et al., 2015).”
Marine Vertebrate Biodiversity and Distribution Within the Central California Current Using Environmental DNA (eDNA) Metabarcoding and Ecosystem Surveys (2019, methodology): “To amplify DNA in each sample, the mitochondrial 12S rRNA gene was amplified using the MiFish-U primers (Miya et al., 2015) (F: GTCGGTAAAACTCGTGCCAGC, R: CATAGTGGGGTATCTAATCCCAGTTTG), which were designed to amplify fish DNA.”
Methods for the extraction, storage, amplification and sequencing of DNA from environmental samples (2018, background): “Frequently, mitochondrial DNA (mtDNA) markers are chosen since the copy number of mtDNA is greater than that of nuclear DNA per cell, thereby increasing the chances of DNA detection when DNA may be present at low concentration, or degraded (Miya et al. 2015).”
Comparing local‐ and regional‐scale estimations of the diversity of stream fish using eDNA metabarcoding and conventional observation methods (2018, methodology): “…70 of the MiFish-U/E primers has been examined using eDNA samples from large aquariums 71 with known species compositions and has demonstrated a high potential to identify fishes 72 (>90% of expected species) from diverse taxonomic species (168 species from 14 orders) 73 (Miya et al., 2015).”
Environmental DNA metabarcoding: Transforming how we survey animal and plant communities (2017, methodology): “sample-specific indexes for the second PCR, which could reduce bias related to index sequence variations (Berry, Mahfoudh, Wagner, & Loy, 2011; Miya et al., 2015; O’Donnell et al., 2016).”
Next‐generation monitoring of aquatic biodiversity using environmental DNA metabarcoding (2016, methodology): “However, to optimize the robustness of the amplification without losing significant taxonomic resolution, we opted for the shorter ‘teleo’ marker, and not for primers similar to those published by Miya et al. (2015).”
Non‐specific amplification compromises environmental DNA metabarcoding with COI (2019, methodology): “E) versions, due to a number of mismatches in the conserved regions (Miya et al., 2015).”
MiFish metabarcoding: a high-throughput approach for simultaneous detection of multiple fish species from environmental DNA and other samples (2020, methodology): “Indeed, the custom reference sequence database in our laboratory (named “MiFish DB”) included 5085 MiFish sequences, covering around 4230 fish species placed in 457 families and 1827 genera, as of 4 October 2014, when the original study was published (Miya et al. 2015).”
Past, present, and future perspectives of environmental DNA (eDNA) metabarcoding: A systematic review in methods, monitoring, and applications of global eDNA (2019, background): “These primers have since been used in numerous fish eDNA metabarcoding studies (Miya et al., 2015).”
Sedimentary eDNA provides different information on timescale and fish species composition compared with aqueous eDNA (2020, methodology): “…eDNA studies on macro-organisms analyzed eDNA in water samples (Goldberg, Strickler, & Fremier, 2018; Ishige et al., 2017; Minamoto et al., 2012; Miya et al., 2015; Ushio et al., 2018; Valentini et al., 2016); however, several recent studies have targeted eDNA in underwater sediments (Buxton,…”