Constitutive expression of ETHYLENE-RESPONSE-FACTOR1 in Arabidopsis confers resistance to several necrotrophic fungi.

By M. Berrocal-Lobo, A. Molina, R. Solano. The Plant Journal, 2002

784 citations recorded by the source corpus.

View Paper: https://www.semanticscholar.org/paper/452c552fa7ad8b6b1f5bd6865c67e4b79bb7d9bb

How researchers see this paper

The researchers whose trusted networks rank it highest, strongest advocate first. Every researcher gets a different order.

In Plant Science

Citations in the corpus

The AP2/ERF Domain Transcription Factor ORA59 Integrates Jasmonic Acid and Ethylene Signals in Plant Defense1[W] (2008, background): “5A; Berrocal-Lobo et al., 2002).”
Conserved MYC transcription factors play a key role in jasmonate signaling both in tomato and Arabidopsis. (2004, background): “Notably, members of the bHLHZIP (MYC-like) family of transcription factors were found to bind preferentially to canonical G-box (CACGTG) elements, although they can also recognize T/G-box sequences like the AACGTG motif identified here (Blackwell et al. 1993).”
Hormone crosstalk in plant disease and defense: more than just jasmonate-salicylate antagonism. (2011, background): “AtMYC2 positively regulates JA-mediated defense against herbivores (11, 113) and is required for suppression of SA defenses during Pst infection (101).”
Insights into the role of jasmonic acid-mediated defenses against necrotrophic and biotrophic fungal pathogens (2012, background): “In contrast, the JA- and ET-mediated pathways are specifically unregulated in response to necrotrophic fungi such as Botrytis cinerea (Berrocal-Lobo et al., 2002; PenaCortes et al., 2004; Glazebrook, 2005).”
Derepression of ethylene-stabilized transcription factors (EIN3/EIL1) mediates jasmonate and ethylene signaling synergy in Arabidopsis (2011, background): “Yeast two-hybrid pGADT7 EIN3 (1-300) BamH1 EIN3-1 CGGGATCCTCATGATGTTTAATGAGATG”
Antagonistic Interaction between Abscisic Acid and Jasmonate-Ethylene Signaling Pathways Modulates Defense Gene Expression and Disease Resistance in Arabidopsis (2004, background): “2 transcript levels (Penninckx et al., 1996) and increased pathogen susceptibility (Thomma et al., 1999; Berrocal-Lobo et al., 2002; Geraats et al., 2002).”
Targeting transgene expression in research, agricultural, and environmental applications: Promoters used in plant transformation (2007, background): “, 1994, 1997), or enhanced susceptibility to other pathogens (Stuiver and Custers, 2001; Berrocal-Lobo et al., 2002).”
Plant hormone-mediated regulation of stress responses (2016, background): “2) and provide resistance against necrotrophic pathogens [33–35].”
Genetic improvement of C4 grasses as cellulosic biofuel feedstocks (2009, background): “TFs of the ERF subfamily have been demonstrated to enhance disease resistance in Arabidopsis and crop plants (Berrocal-Lobo et al. 2002; Guo et al. 2004; Zuo et al. 2007).”
Ethylene Biosynthesis and Signaling Networks Article, publication date, and citation information can be found at www.plantcell.org/cgi/doi/10.1105/tpc.001768. (2002, background): “Recent studies of an ethylene pathway gene ERF1 have shown that activation of ethylene responses by ERF1 overexpression in Arabidopsis plants is sufficient to confer resistance to B. cinerea but reduces SA-mediated tolerance against P. s. tomato DC3000 (Berrocal-Lobo et al., 2002), suggesting a nega”
Worldwide Research on Plant Defense against Biotic Stresses as Improvement for Sustainable Agriculture (2018, background): “Additionally, ERFs have been extensively reported to be involved in the response to pathogen attack [74,75].”
Jasmonate Regulates the INDUCER OF CBF EXPRESSION–C-REPEAT BINDING FACTOR/DRE BINDING FACTOR1 Cascade and Freezing Tolerance in Arabidopsis[W] (2013, background): “Interestingly, a similar dual regulation was observed previously: EIN3 and MYC2 act antagonistically to mediate jasmonate-regulated resistance against the necrotrophic fungal pathogen Botrytis cinerea (Berrocal-Lobo et al., 2002; Lorenzo et al., 2004).”
Tomato stress-responsive factor TSRF1 interacts with ethylene responsive element GCC box and regulates pathogen resistance to Ralstonia solanacearum (2004, methodology): “For Northern blot, disease inoculation was done as by Berrocal-Lobo et al. (2002). Plants were dipped for 6 min in a bacterial suspension in 10 mM 827”