COI1 is a critical component of a receptor for jasmonate and the bacterial virulence factor coronatine

By Leron Katsir, Anthony L. Schilmiller, Paul Staswick, S. He, G. Howe. Proceedings of the National Academy of Sciences of the United States of America, 2008

776 citations recorded by the source corpus.

Subfields: Insect Science, Plant Science

View Paper: https://www.semanticscholar.org/paper/2d37c13d5520d57cd2b42631c13f73489b1ac763

How researchers see this paper

The researchers whose trusted networks rank it highest, strongest advocate first. Every researcher gets a different order.

In Insect Science

In Plant Science

Citations in the corpus

Derepression of ethylene-stabilized transcription factors (EIN3/EIL1) mediates jasmonate and ethylene signaling synergy in Arabidopsis (2011, neutral): “Yeast two-hybrid pGADT7 EIN3 (1-300) BamH1 EIN3-1 CGGGATCCTCATGATGTTTAATGAGATG”
Hormone crosstalk in plant disease and defense: more than just jasmonate-salicylate antagonism. (2011, background): “JAZ proteins bind AtMYC2 and also interact with COI1 through their C-terminal JAS domain (88, 123), forming a stable complex in the presence of (3R,7S)-jasmonoyl-L-isoleucine (55), or the equivalently bioactive coronatine.”
Poplar and Pathogen Interactions: Insights from Populus Genome-Wide Analyses of Resistance and Defense Gene Families and Gene Expression Profiling (2009, background): “syringae, acts as a molecular mimic and is more bioactive than JAs (Katsir et al., 2008b).”
Hormonal modulation of plant immunity. (2012, background): “COR binds directly to the JA receptor COI1 and is much more active in stimulating the JA pathway than JA-Ile is (Katsir et al. 2008, Yang et al. 2009).”
Jasmonate Biosynthesis, Perception and Function in Plant Development and Stress Responses (2013, background): “The only jasmonate receptor identified to date has been the COI1 protein (Katsir et al., 2008; Yan et al., 2009), but interestingly, only JA-Ile was found as a ligand of the SCFCOI1 E3 ubiquitin ligase complex (Thines et al.”
The Arabidopsis CORONATINE INSENSITIVE1 Protein Is a Jasmonate Receptor[C][W] (2009, methodology): “To gain direct evidence that COI1 binds JA-Ile/COR, we made enormous efforts to immobilize His-COI1 to the chip surface.”
Growth-defense tradeoffs in plants: a balancing act to optimize fitness. (2014, neutral): “An increasing concentration of JA-Ile promotes physical interaction between COI1 and JAZ proteins, which leads to ubiquitination and subsequent degradation of JAZs through the 26S proteasome, thereby relieving the repression on MYC transcription factors and initiating the expression of JA-responsive”
Plant Defense Signaling and Responses Against Necrotrophic Fungal Pathogens (2016, neutral): “The enzyme jasmonoyl isoleucine conjugate synthase 1 which is encoded by jar1 gene converts JA into JA-Ile, which is a bioactive derivative in JA signaling (Staswick and Tiryaki 2004; Thines and others 2007; Katsir and others 2008).”
Signaling mechanisms in pattern-triggered immunity (PTI). (2015, background): “The JA receptor is a complex made of coronatineinsensitive 1 (COI1) and jasmonate ZIM domain (JAZ) proteins and inositol pentakisphosphate (Xie et al., 1998; Katsir et al., 2008; Sheard et al., 2010).”