Harnessing homologous recombination in vitro to generate recombinant DNA via SLIC

By Mamie Z. Li, Stephen J. Elledge. Nature Methods, 2007

977 citations recorded by the source corpus.

Subfields: Biotechnology, Genetics, Molecular Biology

View Paper: https://www.semanticscholar.org/paper/2ccccf9637c27b44108da272d2583671e08d951d

How researchers see this paper

The researchers whose trusted networks rank it highest, strongest advocate first. Every researcher gets a different order.

In Biotechnology

In Genetics

In Molecular Biology

Citations in the corpus

Systematic exploration of ubiquitin sequence, E1 activation efficiency, and experimental fitness in yeast (2014, methodology): “SLIC inserts were prepared by 8 cycles of PCR with previously described 27 ubiquitin libraries in p427GPD as template and forward (GATTCTAGAACTAGTAATATG) and reverse primers (TAACTAATTACATGACTCGAG) that bind immediately upstream and downstream of the ubiquitin open reading frame in this template, fo”
Latent Effects of Hsp90 Mutants Revealed at Reduced Expression Levels (2013, methodology): “Point mutant libraries previously generated in p417 plasmids [9] were transferred to the pRS414 promoter variant plasmids using SLIC cloning [57].”
Enzymatic Assembly of Overlapping DNA Fragments (2011, methodology): “An improvement on this method was made and is known as sequence and ligation-independent cloning (SLIC) (Li and Elledge, 2007), which removes the sequence constraints of LIC.”
DNA assembler, an in vivo genetic method for rapid construction of biochemical pathways (2008, methodology): “In addition, unlike the recently reported in vitro SLIC recombination method that requires T4 DNA polymerase and RecA recombinase to treat the DNA substrates before transformation (11), DNA assembler only requires simple DNA preparation via PCR and one-step yeast transformation and yet yields a much”
Fast track assembly of multigene constructs using Golden Gate cloning and the MoClo system (2012, methodology): “Finally, sequence and ligationindependent cloning has allowed up to ten fragments to be assembled in one step, but requires PCR, which is error-prone.(6) Ligation-independent cloning, but also methods based on homologous recombination,(7) requires homology between the fragments to assemble, limiting”
Golden Gate Shuffling: A One-Pot DNA Shuffling Method Based on Type IIs Restriction Enzymes (2009, positive): “A protocol based on ligation-independent cloning has been reported that also allows cloning nine fragments into a vector [26], but efficiency was lower at about 17%.”
Resistance to vemurafenib resulting from a novel mutation in the BRAFV600E kinase domain (2013, methodology): “The mutant pools were then transferred into the retroviral vector pBABEPuro-BRAFV600E (Addgene #15269) by sequence and ligationindependent cloning (SLIC) (Li and Elledge, 2007).”
BglBricks: A flexible standard for biological part assembly (2010, methodology): “Sequence and Ligation Independent Cloning (SLIC) is another PCR-based method that allows the assembly of multiple DNA fragments in a single reaction using in-vitro homologous recombination and singlestrand annealing [27].”