The wheat and barley vernalization gene VRN3 is an orthologue of FT

By Liuling Yan, D. Fu, Chin-Shang Li, A. Blechl, G. Tranquilli, M. Bonafede, Alexandra Sanchez, M. Valárik, S. Yasuda, J. Dubcovsky. Proceedings of the National Academy of Sciences of the United States of America, 2006

1,092 citations recorded by the source corpus.

Subfields: Plant Science

View Paper: https://www.semanticscholar.org/paper/f0965cd9ba5cf6efee6d9531149e4556c2e99a5a

How researchers see this paper

The researchers whose trusted networks rank it highest, strongest advocate first. Every researcher gets a different order.

In Plant Science

1. M. Sorrells
2. S. Chao
3. J. Dubcovsky
4. G. Bai
5. D. Fuller
6. Michael O. Pumphrey
7. Xianchun Xia
8. G. Brown-Guedira

Citations in the corpus

• Regulatory genes involved in the determination of frost tolerance in temperate cereals (2009, background): “1) a homologue of Arabidopsis FT [8,30], which is up-regulated by long days (Fig.”
• SEED DISPERSAL AND CROP DOMESTICATION: SHATTERING, GERMINATION AND SEASONALITY IN EVOLUTION UNDER CULTIVATION (2009, background): “In this case, a dominant mutant allele Vrn3 occurs in wheat that has a retrotransposon in the promoter rendering it insensitive to VRN2 repression, again resulting in a similar phenotype to the mutants described above (Yan et al., 2006).”
• Natural Variation of Flowering Time and Vernalization Responsiveness in Brachypodium distachyon (2010, background): “VRN2 acts to repress VRN3, a homolog of the Arabidopsis FLOWERING LOCUS T (FT) gene, a strong promoter of flowering [7].”
• A Pseudo-Response Regulator is misexpressed in the photoperiod insensitive Ppd-D1a mutant of wheat (Triticum aestivum L.) (2007, background): “Wheat GI and FT homologues were previously described by Zhao et al. (2005) and Yan et al. (2006) but wheat homologues of the barley HvCO1 gene [the counterpart of the rice CO homologue Hd1 (GriYths et al. 2003)] have not been described.”
• Simulation-based analysis of effects of Vrn and Ppd loci on flowering in wheat (2008, background): “2004; Yan et al., 2004) and for additional Vrn loci ( Yan et al., 2006 ) off ers promise for improved discrimination of vernalization response.”
• Genotype-by-Environment Interaction and Plasticity: Exploring Genomic Responses of Plants to the Abiotic Environment (2013, background): “…Photoperiod/ vernalization Protein binding Several Promoter polymorphism Expression DS (Kojima et al. 2002, Lin et al. 2000, Schwartz et al. 2009, Yan et al. 2006) FT Photoperiod Protein binding H. annus Frame shift Expression DS or CN (Blackman et al. 2010) PPD1 Photoperiod 2-component…”
• Genome-wide comparative diversity uncovers multiple targets of selection for improvement in hexaploid wheat landraces and cultivars (2013, background): “No genetic differentiation was detected around the photoperiod regulation genes Ppd-B1 (23),Vrn-2 (36), andVrn-3 (37).”
• Allelic Variation at the Vernalization Genes Vrn‐A1, Vrn‐B1, Vrn‐D1, and Vrn‐B3 in Chinese Wheat Cultivars and Their Association with Growth Habit (2008, background): “…63 1 min Fu et al., 2005 Vrn-B3 Vrn-B3 VRN4-B-INS-F VRN4-B-INS-R CATAATGCCAAGCCGGTGAGTAC ATGTCTGCCAATTAGCTAGC ~1200 63 1 min 10 s Yan et al., 2006 vrn-B3 VRN4-BNOINS-F VRN4-BNOINS-R ATGCTTTCGCTTGCCATCC CTATCCCTACCGGCCATTAG ~1140 57 1 min 5 s Yan et al., 2006 Cultivar Days to…”