Environmental DNA: For Biodiversity Research and Monitoring

By Aurélie Bonin, P. Taberlet, Lucie Zinger. 2018

674 citations recorded by the source corpus.

View Paper: https://www.semanticscholar.org/paper/f07595e2a7f558b6e68f5d6f2cfbed39f41f72a1

How researchers see this paper

The researchers whose trusted networks rank it highest, strongest advocate first. Every researcher gets a different order.

Citations in the corpus

Comparing environmental DNA metabarcoding and underwater visual census to monitor tropical reef fishes (2020, unknown): “…-ACACCGCCCGTCACTCTC, reverse: -CATGTTACGACTTGCCTCCTC), teleosteans (teleo/Tele01, forward: -ACACCGCCCGTCACTCT, reverse: -CTTCCGGTACACTTACCATG) and more generally vertebrates (Vert01, forward: -TAGAACAGGCTC CTCTAG, reverse: -TTAGATACCCCACTATGC) (Taberlet et al., 2018; Valentini et al., 2016).”
Trawl and eDNA assessment of marine fish diversity, seasonality, and relative abundance in coastal New Jersey, USA (2021, background): “Technical factors related to PCR can distort eDNA findings, including co-purification of inhibitors along with DNA, primer bias, unrecognized cross-contamination, and non-linear amplification kinetics (Jerde et al., 2011; Roussel et al., 2015; Taberlet et al., 2018; Kelly et al., 2019).”
From environmental DNA sequences to ecological conclusions: How strong is the influence of methodological choices? (2019, background): “This feature is particularly relevant for DNA metabarcoding data, since artefactual sequences are usually rare compared to the genuine ones (Bálint et al., 2016; Taberlet et al., 2018).”
Non‐specific amplification compromises environmental DNA metabarcoding with COI (2019, background): “R CATAGTGGGGTATCTAATCCTAGTTTG Taberlet‐tele02 Tele02-f AAACTCGTGCCAGCCACC 167 Taberlet et al. (2018)Tele02-r GGGTATCTAATCCCAGTTTG Taberlet‐elas02 Elas02-f GTTGGTHAATCTCGTGCCAGC 171 Taberlet et al. (2018)Elas02-r CATAGTAGGGTATCTAATCCTAGTTTG Valentini‐tele01 L1848 ACACCGCCCGTCACTCT 63 Valentini et…”