Detection of loop-mediated isothermal amplification reaction by turbidity derived from magnesium pyrophosphate formation.
By Yasuyoshi Mori, K. Nagamine, Norihiro Tomita, T. Notomi. Biochemical and Biophysical Research Communications - BBRC, 2001
1,715 citations recorded by the source corpus.
Subfields: Biomedical Engineering, Immunology, Molecular Biology
View Paper: https://www.semanticscholar.org/paper/e97146748df48ee5f2abb79c8d1ec5d60245d6d4
How researchers see this paper
The researchers whose trusted networks rank it highest, strongest advocate first. Every researcher gets a different order.
In Biomedical Engineering
In Molecular Biology
Citations in the corpus
- Loop-Mediated Isothermal Amplification for Direct Detection of Mycobacterium tuberculosis Complex, M. avium, and M. intracellulare in Sputum Samples (2003, positive): “LAMP has the following characteristics: (i) all reactions can be conducted under isothermal conditions ranging from 60 to 65°C by using only one type of enzyme; (ii) the specificity of the reaction is extremely high because it uses four primers recognizing six distinct regions on the target DNA; (ii”
- Visual and Rapid Detection of Two Genetically Modified Soybean Events Using Loop-mediated Isothermal Amplification Method (2010, methodology): “89788-F ACGTAGACACGTCGAAATAAAGATT 3′ junction of MON 89788 Mori et al. (2001) 89788-R GGAAGAGGCTGAAATGCTTG 316 Food Anal.”
- Real-time turbidimetry of LAMP reaction for quantifying template DNA. (2004, background): “These results indicate that the kinetic analysis of the LAMP reaction by real-time turbidimetry has the capability of quantifying DNA over a wide dynamic range as well as simple qualitative detection of DNA [15].”
- Diagnosing COVID-19: The Disease and Tools for Detection (2020, methodology): “62 The reaction occurs in <1 h at 60− 65°C with an analytical limit of detection of ∼75 copies per μL.”
- Loop mediated isothermal amplification (LAMP): a new generation of innovative gene amplification technique; perspectives in clinical diagnosis of infectious diseases (2008, methodology): “Following amplification, the tubes can be inspected for white turbidity through naked eye after a pulse spin to deposit the precipitate in the bottom of the tube (Figure 4C) [3].”
- Advanced methods of plant disease detection. A review (2014, neutral): “Loop-mediated isothermal amplification (LAMP) detects amplicons via photometry for solution turbidity (Mori et al. 2001).”
- Loop-mediated isothermal amplification (LAMP) of gene sequences and simple visual detection of products (2008, background): “As pyrophosphate ion can strongly bind with metal ions and form insoluble salts, as a result, the concentration of metal ion will significantly decreas”