Differential effects of Wx-A1, -B1 and -D1 protein deficiencies on apparent amylose content and starch pasting properties in common wheat

By M. Yamamori, N. T. Quỳnh. Theoretical and Applied Genetics, 2000

163 citations recorded by the source corpus.

Subfields: Biomedical Engineering, Nutrition and Dietetics, Plant Science

View Paper: https://www.semanticscholar.org/paper/d16b1dca2e9e0c94a4406b9c8d7c4e7eab9a442d

How researchers see this paper

The researchers whose trusted networks rank it highest, strongest advocate first. Every researcher gets a different order.

In Plant Science

1. Xianchun Xia
2. Zhonghu He

Citations in the corpus

• Characterization of CIMMYT bread wheats for high- and low-molecular weight glutenin subunits and other quality-related genes with SDS-PAGE, RP-HPLC and molecular markers (2010, methodology): “Yamamori and Quynh (2000) reported that the Wx-B1b induced lower amylase content, which was confirmed by Table 1 PCR primers of the molecular markers used in the study Marker/gene Forward and reverse primers (50-30) Allele Fragment size (bp) References Ax2* F: ATGACTAAGCGGTTGGTTCTT Glu-Ax2* 1319 Ma…”