Analysis of rRNA gene content in the Mediterranean dinoflagellate Alexandrium catenella and Alexandrium taylori: implications for the quantitative real-time PCR-based monitoring methods

By L. Galluzzi, E. Bertozzini, A. Penna, F. Perini, E. Garcés, M. Magnani. Journal of Applied Phycology, 2010

122 citations recorded by the source corpus.

Subfields: Ecology, Environmental Chemistry, Oceanography

View Paper: https://www.semanticscholar.org/paper/ba4b1dd455bce9693e8cc61313d7c1c9374ea61f

How researchers see this paper

The researchers whose trusted networks rank it highest, strongest advocate first. Every researcher gets a different order.

In Ecology

1. D. Anderson
2. Tilman J. Alpermann
3. Marina Montresor

In Environmental Chemistry

1. Tilman J. Alpermann
2. D. Anderson
3. Marina Montresor
4. A. Cembella
5. Y. Collos
6. E. Masseret
7. G. Hallegraeff
8. U. Tillmann

In Oceanography

1. A. Cembella
2. Tilman J. Alpermann
3. Y. Collos
4. D. Anderson
5. E. Masseret
6. Marina Montresor

Citations in the corpus

• The globally distributed genus Alexandrium: multifaceted roles in marine ecosystems and impacts on human health (2012, background): “8S-ITS2 Alexandrium taylorii Tay50 TGGTGTTTGAATGCGGTTGT Galluzzi et al. (2010) Tay30 AGGAAATGGCACCAGAATGC 18S-ITS1-5.”