The effect of ocean acidification on symbiont photorespiration and productivity in Acropora formosa
By A. Crawley, David I. Kline, S. Dunn, Kenneth R. N. Anthony, Sophie Dove. 2010
192 citations recorded by the source corpus.
Subfields: Ecology, Oceanography
View Paper: https://www.semanticscholar.org/paper/b46bae25f8e47c2e0ca0bdaa253b59654f406916
How researchers see this paper
The researchers whose trusted networks rank it highest, strongest advocate first. Every researcher gets a different order.
In Ecology
- Ruth D. Gates
- David John Suggett
- Peter J. Edmunds
- S. Davies
- A. Marchetti
- Hollie Putnam
- T. Fan
- Chii‐Shiarng Chen
In Oceanography
- Mark E. Warner
- Ruth D. Gates
- David John Suggett
- A. Marchetti
- S. Davies
- David J. Smith
- Hollie Putnam
- T. Fan
Citations in the corpus
- A corrosive concoction: The combined effects of ocean warming and acidification on the early growth of a stony coral are multiplicative (2011, background): “, 2009) andmore severe photorespiration compared to low pH and subsaturated light conditions (Crawley et al., 2010).”
- Breakdown of the coral-algae symbiosis: towards formalising a linkage between warm-water bleaching thresholds and the growth rate of the intracellular zooxanthellae (2012, unknown): “Furthermore, although persuasive evidence exist to suggest that the intracellular zooxanthellae can become CO2-limited under high irradiance conditions (see e.g. Goiran et al., 1996; Crawley et al., 2010), it is important that future experiments specifically target any contributing impact of thermal”
- Differential effects of ocean acidification on growth and photosynthesis among phylotypes of Symbiodinium (Dinophyceae) (2011, background): “While we have focused on the free-living state of Symbiodinium, and focus should continue on how OA affects the viability and photosynthetic performance in hospite (Langdon and Atkinson 2005; Crawley et al. 2010).”
- The physiological and molecular responses of larvae from the reef-building coral Pocillopora damicornis exposed to near-future increases in temperature and pCO2 (2012, methodology): “( C) Cycle # SolarisTM spike Exogenous NA TGCAAAGCCAATTCCCGAAG CCATTGTAGTGAACAGTAGGAC 125 63 35 hsp70 (62 bp) Coral AB201749 ATCCAGGCAGCGGTCTTGT TCGAGCAGCAGGATATCACTGA 300 60 35 hsp70 (86 bp) Symbiodinium EU476880 CTGTCCATGGGCCTGGAGACT GTGAACGTCTGTGCCTTGTTGGTT 500 62.5 33 apx1 (107 bp) Symbiodinium ”
- Zooplanktivory ameliorates the effects of ocean acidification on the reef coral Porites spp (2011, background): “Although data on this topic are sparse, this does seem to be the case for Acropora formosa, in which light-enhanced dark respiration (LEDR; but not dark respiration) increases 81% at 111 Pa CO2 compared to 38 Pa CO2 (Crawley et al. 2010).”
- Symbiodinium Functional Diversity in the Coral Siderastrea siderea Is Influenced by Thermal Stress and Reef Environment, but Not Ocean Acidification (2018, background): “Some studies report that elevated pCO2 enhances Symbiodinium primary production, suggesting that the concentration of dissolved inorganic carbon in seawater—elevated under high pCO2–is the limiting substrate for photosynthesis (Crawley et al., 2010; Brading et al., 2011).”