MSIsensor: microsatellite instability detection using paired tumor-normal sequence data

By Beifang Niu, Kai Ye, Qunyuan Zhang, Charles Lu, Mingchao Xie, M. McLellan, Michael C. Wendl, Li Ding. Bioinform., 2014

724 citations recorded by the source corpus.

How researchers see this paper

The researchers whose trusted networks rank it highest, strongest advocate first. Every researcher gets a different order.

Clinical sequencing defines the genomic landscape of metastatic colorectal cancer (2018, neutral): “…APC_forward: 5’AGAAATCAACATGGCAACT 3’ This paper N/A Primer: APC_reverse: 5’ACTAGAACTCAAAACACTGG 3’ This paper N/A Software and Algorithms MSIsensor Niu et al., 2014 N/A MuSiC Dees et al., 2012 http://gmt.genome.wustl.edu/packages/ genome-music/ MutSigCV 1.4 Lawrence et al., 2013…”
ESMO recommendations on microsatellite instability testing for immunotherapy in cancer, and its relationship with PD-1/PD-L1 expression and tumour mutational burden: a systematic review-based approach. (2019, background): “NGS can also determine MSI status [101–103]; a recently developed ‘MSIsensor’ combines NGS with biostatistics to address MSI in tumour samples [101, 102].”
Comprehensive Characterization of Cancer Driver Genes and Mutations (2018, methodology): “MSIsensor Written in C++, MSIsensor (version 0.2) is an algorithm that distinguishes microsatellite instable (MSI) tumors frommicrosatellite stable (MSS) samples based on tumor/normal sequence data (Niu et al., 2014).”