Large deletions within the first intron in VRN-1 are associated with spring growth habit in barley and wheat

By D. Fu, P. Szűcs, Liuling Yan, M. Helguera, J. S. Skinner, Jarislav von Zitzewitz, P. Hayes, J. Dubcovsky. Zeitschrift für Induktive Abstammungs- und Vererbungslehre, 2005

677 citations recorded by the source corpus.

Subfields: Genetics, Plant Science

View Paper: https://www.semanticscholar.org/paper/8e2cc5096e488fe1f584303440d4c295ed2b1dbf

How researchers see this paper

The researchers whose trusted networks rank it highest, strongest advocate first. Every researcher gets a different order.

In Genetics

In Plant Science

Citations in the corpus

Allelic Variation at the Vernalization Genes Vrn‐A1, Vrn‐B1, Vrn‐D1, and Vrn‐B3 in Chinese Wheat Cultivars and Their Association with Growth Habit (2008, background): “…TCATCCATCATCAAGGCAAA 1068 58 1 min 5 s Fu et al., 2005 Vrn-B1 Vrn-B1 Intr1/B/F Intr1/B/R3 CAAGTGGAACGGTTAGGACA CTCATGCCAAAAATTGAAGATGA 709 63 43 s Fu et al., 2005 vrn-B1 Intr1/B/F Intr1/B/R4 CAAGTGGAACGGTTAGGACA CAAATGAAAAGGAATGAGAGCA 1149 58 1 min 9 s Fu et al., 2005 Vrn-D1 Vrn-D1 Intr1/D/F…”
Molecular characterization of the allelic variation at the VRN-H2 vernalization locus in barley (2005, background): “Morex and H. spontaneum VRN-H1 genes do not have sequence differences in the promoter but differ in a large deletion in intron one (Fu et al. 2005).”
Evaluation of Genetic Diversity and Genome‐wide Linkage Disequilibrium among U.S. Wheat (Triticum aestivum L.) Germplasm Representing Different Market Classes (2007, background): “This might be related to the fact that spring growth habit can be conferred independently by mutations in any of the three copies of the Vrn-1 gene ( Vrn-A1 , Vrn-B1 , or Vrn-D1 ; Yan et al., 2004; Fu et al., 2005) relaxing the selection pressure.”
Developmental Gene Evolution and the Origin of Grass Inflorescence Diversity (2006, background): “Grass FUL1 proteins in barley, ryegrass, oats, and wheat have all been implicated in vernalization‐induced competence to flower (Danyluk et al., 2003; Fu et al., 2005; Jensen et al., 2005; Trevaskis et al., 2003; Yan et al., 2003).”
Genetic analysis of flowering and maturity time in high latitude spring wheat (2007, background): “Polymerase chain reaction (PCR) markers now available can facilitate the rapid characterization of wheat germplasm for Vrn genes and hence lead to a better understanding of the adaptive value of different Vrn alleles in a particular growing region (Yan et al. 2004; Fu et al. 2005).”
Genetic and Molecular Characterization of Vernalization Genes Vrn-A1, Vrn-B1, and Vrn-D1 in Spring Wheat Germplasm from the Pacific Northwest Region of the U.S.A. (2009, background): “2004, Fu et al. 2005), and our results aligned with previously reported results in 15 of 16 cases. For the cultivar Calorwa , we identified Vrn-A1a, Vrn-B1 and Vrn-D1, whereas Fu et al. (2005) reported Vrn-A1a, vrn-B1 and vrn-D1.”
A Pseudo-Response Regulator is misexpressed in the photoperiod insensitive Ppd-D1a mutant of wheat (Triticum aestivum L.) (2007, background): “The mechanism by which the deletion causes misexpression could be by removal of regulatory elements, as previously shown for mutations conferring spring growth habit in the Vrn1 gene (Yan et al. 2003; Fu et al. 2005), and/or the alteration of the transcription start site.”